snplib 1.0.10__tar.gz → 1.2.10__tar.gz

{snplib-1.0.10 → snplib-1.2.10}/.gitignore

@@ -17,6 +17,8 @@
 !requirements.txt
 !/tests/*/**
 !/docs/*/**
+/docs/_build
+
 
 *.idea*
 *__pycache__*

{snplib-1.0.10/src/snplib.egg-info → snplib-1.2.10}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.2
 Name: snplib
-Version: 1.0.10
+Version: 1.2.10
 Summary: Snptools is a tool for Single Nucleotide Polymorphism (SNP) data processing
 Author-email: Igor <igor.loschinin@gmail.com>
 License: GNU
@@ -10,14 +10,14 @@ Classifier: Operating System :: OS Independent
 Requires-Python: >=3.10
 Description-Content-Type: text/markdown
 License-File: LICENSE
-Requires-Dist: numpy>=1.26.1
-Requires-Dist: pandas>=2.1.1
-Requires-Dist: six>=1.16.0
+Requires-Dist: numpy>=2.2.3
+Requires-Dist: pandas>=2.2.3
+Requires-Dist: six>=1.17.0
 Requires-Dist: swifter>=1.4.0
 Requires-Dist: xlrd>=2.0.1
-Requires-Dist: XlsxWriter>=3.1.9
-Requires-Dist: openpyxl>=3.1.2
-Requires-Dist: pydantic>=2.4.2
+Requires-Dist: XlsxWriter>=3.2.2
+Requires-Dist: openpyxl>=3.1.5
+Requires-Dist: pydantic>=2.10.6
 
 # snptools
 <p align="center">

{snplib-1.0.10 → snplib-1.2.10}/docs/conf.py

@@ -8,7 +8,7 @@
 
 import os
 import sys
-sys.path.insert(0, os.path.abspath('../src/snplib'))
+sys.path.insert(0, os.path.abspath('../src'))
 
 project = 'snptools'
 copyright = '2025, Igor Locshinin'

{snplib-1.0.10 → snplib-1.2.10}/docs/examples.rst

@@ -73,6 +73,31 @@ Output::
 
         ...
 
+To handle large files, use `usecols` and `dtype`. This reduces memory
+consumption and speeds up processing.
+
+.. note::
+    `usecols` is used when `allele` is **None**.
+
+.. code-block:: python
+
+        alleles_ab = FinalReport(
+            usecols=['SNP Name', 'Sample ID', 'Allele1 - AB', 'Allele2 - AB'],
+            dtype={'SNP Name': 'category'}
+        )
+        alleles_ab.handle("path/to/finalreport.txt")
+        data_ab = alleles_ab.snp_data
+
+Output::
+
+        SNP Name    Sample ID    Allele1 - AB  Allele2 - AB
+        ARS-BFGL-BAC-10172 HO840M003135245650 B B
+        ARS-BFGL-BAC-1020 HO840M003135245650 B B
+        ARS-BFGL-BAC-10245 HO840M003135245650 B B
+        ARS-BFGL-BAC-10345 HO840M003135245650 A B
+        ARS-BFGL-BAC-10375 HO840M003135245650 A B
+        ...
+
 Preparation SNP files
 ---------------------
 
@@ -90,7 +115,19 @@ plink - GBLUP, ssGBLUP, GWAS.
 blupf90 format
 ______________
 The input data for obtaining the ``snp.txt`` file used for the genomic
-blupf90 evaluation is the data file - processed file ``finalreport.txt``
+blupf90 evaluation is the data file - processed file ``finalreport.txt``.
+The processed file can be seen in the item above - Finalreport.txt processing:
+
+Content input *file.txt*::
+
+        SNP Name    Sample ID    Allele1 - AB  Allele2 - AB     GC Score    X Y
+        ARS-BFGL-BAC-10172 HO840M003135245650 B B 0.9420 0.069 0.801
+        ARS-BFGL-BAC-1020 HO840M003135245650 B B 0.9489 0.033 0.700
+        ARS-BFGL-BAC-10245 HO840M003135245650 B B 0.7277 0.152 1.504
+        ARS-BFGL-BAC-10345 HO840M003135245650 A B 0.9411 0.598 0.572
+        ARS-BFGL-BAC-10375 HO840M003135245650 A B 0.9348 0.430 0.494f
+
+        ...
 
 **uga**
 
@@ -99,7 +136,7 @@ blupf90 evaluation is the data file - processed file ``finalreport.txt``
     import pandas as pd
     from snplib.format import Snp
 
-    data_finalreport = pd.read_csv("file.txt", sep="\t")
+    data_finalreport = pd.read_csv("path_to_file/file.txt", sep="\t")
 
     obj = Snp(fmt="uga")
     obj_snp.process(data_finalreport)
@@ -111,7 +148,7 @@ Data after snp processing in ``uga`` (blupf90) format - obj_snp.data::
     0     14814  02011015010000500
     1     14815  01110152120222512
 
-Default result::
+Default result - this is what the data looks like if ``fmt=None``::
 
                     SNP_NAME SAMPLE_ID SNP
     0               ABCA12     14814   0
@@ -130,16 +167,104 @@ ____________
 
 This page describes specialized PLINK input and output file formats which are
 identifiable by file extension. https://www.cog-genomics.org/plink/1.9/formats
-Распространненные фомраты для проведения GWAS анализа - ``ped``, ``map``, ``fam``, ``lgen``...
+Common fomrats for performing GWAS analysis - ``ped``, ``map``, ``fam``, ``lgen``....
 
 **map** - https://www.cog-genomics.org/plink/1.9/formats#map
 
+To get the ``.map`` file, first you need to download the *manifest file* for the chip
+you are using chip.
+
+.. note::
+    *file_bovinesnp50.csv* - The file that is taken on the Illumina website with full
+    information about the chip https://support.illumina.com/downloads/bovinesnp50-v3-0-product-files.html
+
+Since the make_map function accepts **pd.DataFrame**, the *manifest file* processing is performed
+independently.
+
+Input data for make_map::
+
+                                           IlmnID  ... BeadSetID
+    0       BovineHD0100037694-128_T_F_2278925834  ...      1241
+    1   BovineHD0100037699_dup-128_T_F_2327674593  ...      1241
+    2   BovineHD0100037703_dup-128_B_R_2327674602  ...      1241
+    3   BovineHD0100037704_dup-128_T_F_2327674603  ...      1241
+    4   BovineHD0100037710_dup-128_T_F_2327674613  ...      1241
+    5   BovineHD0100037712_dup-128_B_R_2327674618  ...      1241
+    6       BovineHD0100037716-128_T_F_2255347065  ...      1241
+    7       BovineHD0100037719-128_T_F_2278926219  ...      1241
+    8       BovineHD0100037720-128_B_R_2255342455  ...      1241
+    9   BovineHD0100037722_dup-128_B_R_2327674634  ...      1241
+
+
+.. note::
+    The original file, for example, **BovineSNP50_v3_A1.csv** looks like this::
+
+        Illumina, Inc.,,,,,,,,,,,,,,,,,
+        [Heading],,,,,,,,,,,,,,,,,,
+        Descriptor File Name,BovineSNP50_v3_A1.bpm,,,,,,,,,,,,,,,,,
+        Assay Format,Infinium HTS,,,,,,,,,,,,,,,,,
+        Date Manufactured,1/14/2016,,,,,,,,,,,,,,,,,
+        Loci Count ,53218,,,,,,,,,,,,,,,,,
+        [Assay],,,,,,,,,,,,,,,,,,
+        IlmnID,Name,IlmnStrand,SNP,AddressA_ID,AlleleA_ProbeSeq,AddressB_ID,AlleleB_ProbeSeq,GenomeBuild,Chr,MapInfo,Ploidy,Species,Source,SourceVersion,SourceStrand,SourceSeq,TopGenomicSeq,BeadSetID
+        ABCA12_r2-1_T_F_2277749139,ABCA12,TOP,[A/G],0059616496,CTTGTCTTCTTTTGGAATGTTACAGGTATGGTATGATCCAGAAGGCTATC,,,0,2,103548215,diploid,Bos taurus,UMD3.1,1,TOP,ACTCTGGTGGATGGTTCATAATCTGCTAAGATGAATAAGTTACTGGGGAAACTGGTGCATTTATTTTAAATATAAATTATATAGTCTGTAAGATATAAAGACTGCCTAATTTATTTGAACACCATACTGATCTTGTCTTCTTTTGGAATGTTACAGGTATGGTATGATCCAGAAGGCTATC[A/G]CTCCCTTCCAGCTTACCTCAACAGCCTGAATAATTTCCTCCTGCGAGTTAACATGTCAAAATATGATGCTGCCCGACATGGTAAAGTTATTTACATAGGAGCTCCTTGTATTGAAACTCTTGCTACTCTCCATGTGAAAATATACATTAGACCCCATTTTCCTCCCTGTGGCAGCTAT,ACTCTGGTGGATGGTTCATAATCTGCTAAGATGAATAAGTTACTGGGGAAACTGGTGCATTTATTTTAAATATAAATTATATAGTCTGTAAGATATAAAGACTGCCTAATTTATTTGAACACCATACTGATCTTGTCTTCTTTTGGAATGTTACAGGTATGGTATGATCCAGAAGGCTATC[A/G]CTCCCTTCCAGCTTACCTCAACAGCCTGAATAATTTCCTCCTGCGAGTTAACATGTCAAAATATGATGCTGCCCGACATGGTAAAGTTATTTACATAGGAGCTCCTTGTATTGAAACTCTTGCTACTCTCCATGTGAAAATATACATTAGACCCCATTTTCCTCCCTGTGGCAGCTAT,1241
+        APAF1_dup-1_B_F_2327661418,APAF1,BOT,[T/C],0041654401,ATATTGTGCAACTGGGCCTCTGTGAACTGGAAACTTCAGAGGTTTATCGG,,,0,5,63150400,diploid,Bos taurus,UMD3.1,1,BOT,CCATTTCCTAATATTGTGCAACTGGGCCTCTGTGAACTGGAAACTTCAGAGGTTTATCGG[T/C]AAGCTAAGCTGCAGGCCAAGCAGGAGGTCGATAACGGAATGCTTTACCTGGAGTGGGTGT,ACACCCACTCCAGGTAAAGCATTCCGTTATCGACCTCCTGCTTGGCCTGCAGCTTAGCTT[A/G]CCGATAAACCTCTGAAGTTTCCAGTTCACAGAGGCCCAGTTGCACAATATTAGGAAATGG,1241
+        ARS-BFGL-BAC-10172_dup-0_T_F_2328966397,ARS-BFGL-BAC-10172,TOP,[A/G],0072620471,GGTCCCCAAAGTATGTGGTAGCACTTACTTATGTAAGTCATCACTCAAGT,,,3,14,6371334,diploid,Bos taurus,UM3,0,TOP,CTCAGAAGTTGGTCCCCAAAGTATGTGGTAGCACTTACTTATGTAAGTCATCACTCAAGT[A/G]ATCCAGAATATTCTTTTAGTAATATTTTTGTTAATATTGAAATTTTTAAAACAATTGAAA,CTCAGAAGTTGGTCCCCAAAGTATGTGGTAGCACTTACTTATGTAAGTCATCACTCAAGT[A/G]ATCCAGAATATTCTTTTAGTAATATTTTTGTTAATATTGAAATTTTTAAAACAATTGAAA,1241
+        .
+        .
+        .
+        UA-IFASA-9812_dup-0_B_F_2329051536,UA-IFASA-9812,BOT,[T/C],0031677304,ACCTCCATAGCTGATAGGAATGGTCTCAACTTGCAGCCCCATTATACTAA,,,3,29,48012818,diploid,Bos taurus,UM3,0,BOT,GTAAAAACAAACCTCCATAGCTGATAGGAATGGTCTCAACTTGCAGCCCCATTATACTAA[T/C]GATGATCTGAAGTTTCTCAAGCACGCAGAGAAACGTAAGAGAAACGTTCCAGCAAAGGGA,TCCCTTTGCTGGAACGTTTCTCTTACGTTTCTCTGCGTGCTTGAGAAACTTCAGATCATC[A/G]TTAGTATAATGGGGCTGCAAGTTGAGACCATTCCTATCAGCTATGGAGGTTTGTTTTTAC,1241
+        UA-IFASA-9813_dup-0_B_F_2329051538,UA-IFASA-9813,BOT,[T/C],0011661313,ACCTTTGCACTCGCTAACGGTTCAGCATTAATCAGACTTCCTCAGGAATT,,,3,19,32508700,diploid,Bos taurus,UM3,0,BOT,AATAAAACCAACCTTTGCACTCGCTAACGGTTCAGCATTAATCAGACTTCCTCAGGAATT[T/C]AGGGGTCAATTCCCCCATGTCTAAAATTGAACCTCAACGTCCTTTCTGTTTTCAAAACTC,GAGTTTTGAAAACAGAAAGGACGTTGAGGTTCAATTTTAGACATGGGGGAATTGACCCCT[A/G]AATTCCTGAGGAAGTCTGATTAATGCTGAACCGTTAGCGAGTGCAAAGGTTGGTTTTATT,1241
+        UMPS_dup-1_T_R_2327737250,UMPS,TOP,[A/G],0073777348,TAACTGAACTCCTGGAGTCAAGTGAAGAAATTCTGGTTTCATGCTTACTC,,,0,1,69756880,diploid,Bos taurus,UMD3.1,1,BOT,TCATCTGTTGATTACATTCCATTCAGGTGCAAATGGCTGAAGAACATTCTGAATTTGTGATTGGTTTTATTTCTGGCTCC[T/C]GAGTAAGCATGAAACCAGAATTTCTTCACTTGACTCCAGGAGTTCAGTTAGAAGCAGGAGGTAAGCCTATTGATTGGTAA,TTACCAATCAATAGGCTTACCTCCTGCTTCTAACTGAACTCCTGGAGTCAAGTGAAGAAATTCTGGTTTCATGCTTACTC[A/G]GGAGCCAGAAATAAAACCAATCACAAATTCAGAATGTTCTTCAGCCATTTGCACCTGAATGGAATGTAATCAACAGATGA,1241
+        [Controls],,,,,,,,,,,,,,,,,,
+        0027630314,Staining,Red,DNP (High),,,,,,,,,,,,,,,
+        0029619375,Staining,Purple,DNP (Bgnd),,,,,,,,,,,,,,,
+        0041666334,Staining,Green,Biotin (High),,,,,,,,,,,,,,,
+        0034648333,Staining,Blue,Biotin (Bgnd),,,,,,,,,,,,,,,
+        0017616306,Extension,Red,Extension (A),,,,,,,,,,,,,,,
+        0014607337,Extension,Purple,Extension (T),,,,,,,,,,,,,,,
+
+    Therefore, for direct reading via **pd.read_csv()** it is necessary to
+    preprocess the file - delete extra lines::
+
+        Illumina, Inc.,,,,,,,,,,,,,,,,,
+        [Heading],,,,,,,,,,,,,,,,,,
+        Descriptor File Name,BovineSNP50_v3_A1.bpm,,,,,,,,,,,,,,,,,
+        Assay Format,Infinium HTS,,,,,,,,,,,,,,,,,
+        Date Manufactured,1/14/2016,,,,,,,,,,,,,,,,,
+        Loci Count ,53218,,,,,,,,,,,,,,,,,
+        [Assay],,,,,,,,,,,,,,,,,,
+
+        and
+
+        [Controls],,,,,,,,,,,,,,,,,,
+        0027630314,Staining,Red,DNP (High),,,,,,,,,,,,,,,
+        0029619375,Staining,Purple,DNP (Bgnd),,,,,,,,,,,,,,,
+        0041666334,Staining,Green,Biotin (High),,,,,,,,,,,,,,,
+        0034648333,Staining,Blue,Biotin (Bgnd),,,,,,,,,,,,,,,
+        0017616306,Extension,Red,Extension (A),,,,,,,,,,,,,,,
+        0014607337,Extension,Purple,Extension (T),,,,,,,,,,,,,,,
+
+    The file should end up looking like this::
+
+        IlmnID,Name,IlmnStrand,SNP,AddressA_ID,AlleleA_ProbeSeq,AddressB_ID,AlleleB_ProbeSeq,GenomeBuild,Chr,MapInfo,Ploidy,Species,Source,SourceVersion,SourceStrand,SourceSeq,TopGenomicSeq,BeadSetID
+        ABCA12_r2-1_T_F_2277749139,ABCA12,TOP,[A/G],0059616496,CTTGTCTTCTTTTGGAATGTTACAGGTATGGTATGATCCAGAAGGCTATC,,,0,2,103548215,diploid,Bos taurus,UMD3.1,1,TOP,ACTCTGGTGGATGGTTCATAATCTGCTAAGATGAATAAGTTACTGGGGAAACTGGTGCATTTATTTTAAATATAAATTATATAGTCTGTAAGATATAAAGACTGCCTAATTTATTTGAACACCATACTGATCTTGTCTTCTTTTGGAATGTTACAGGTATGGTATGATCCAGAAGGCTATC[A/G]CTCCCTTCCAGCTTACCTCAACAGCCTGAATAATTTCCTCCTGCGAGTTAACATGTCAAAATATGATGCTGCCCGACATGGTAAAGTTATTTACATAGGAGCTCCTTGTATTGAAACTCTTGCTACTCTCCATGTGAAAATATACATTAGACCCCATTTTCCTCCCTGTGGCAGCTAT,ACTCTGGTGGATGGTTCATAATCTGCTAAGATGAATAAGTTACTGGGGAAACTGGTGCATTTATTTTAAATATAAATTATATAGTCTGTAAGATATAAAGACTGCCTAATTTATTTGAACACCATACTGATCTTGTCTTCTTTTGGAATGTTACAGGTATGGTATGATCCAGAAGGCTATC[A/G]CTCCCTTCCAGCTTACCTCAACAGCCTGAATAATTTCCTCCTGCGAGTTAACATGTCAAAATATGATGCTGCCCGACATGGTAAAGTTATTTACATAGGAGCTCCTTGTATTGAAACTCTTGCTACTCTCCATGTGAAAATATACATTAGACCCCATTTTCCTCCCTGTGGCAGCTAT,1241
+        APAF1_dup-1_B_F_2327661418,APAF1,BOT,[T/C],0041654401,ATATTGTGCAACTGGGCCTCTGTGAACTGGAAACTTCAGAGGTTTATCGG,,,0,5,63150400,diploid,Bos taurus,UMD3.1,1,BOT,CCATTTCCTAATATTGTGCAACTGGGCCTCTGTGAACTGGAAACTTCAGAGGTTTATCGG[T/C]AAGCTAAGCTGCAGGCCAAGCAGGAGGTCGATAACGGAATGCTTTACCTGGAGTGGGTGT,ACACCCACTCCAGGTAAAGCATTCCGTTATCGACCTCCTGCTTGGCCTGCAGCTTAGCTT[A/G]CCGATAAACCTCTGAAGTTTCCAGTTCACAGAGGCCCAGTTGCACAATATTAGGAAATGG,1241
+        ARS-BFGL-BAC-10172_dup-0_T_F_2328966397,ARS-BFGL-BAC-10172,TOP,[A/G],0072620471,GGTCCCCAAAGTATGTGGTAGCACTTACTTATGTAAGTCATCACTCAAGT,,,3,14,6371334,diploid,Bos taurus,UM3,0,TOP,CTCAGAAGTTGGTCCCCAAAGTATGTGGTAGCACTTACTTATGTAAGTCATCACTCAAGT[A/G]ATCCAGAATATTCTTTTAGTAATATTTTTGTTAATATTGAAATTTTTAAAACAATTGAAA,CTCAGAAGTTGGTCCCCAAAGTATGTGGTAGCACTTACTTATGTAAGTCATCACTCAAGT[A/G]ATCCAGAATATTCTTTTAGTAATATTTTTGTTAATATTGAAATTTTTAAAACAATTGAAA,1241
+        .
+        .
+        .
+        UA-IFASA-9812_dup-0_B_F_2329051536,UA-IFASA-9812,BOT,[T/C],0031677304,ACCTCCATAGCTGATAGGAATGGTCTCAACTTGCAGCCCCATTATACTAA,,,3,29,48012818,diploid,Bos taurus,UM3,0,BOT,GTAAAAACAAACCTCCATAGCTGATAGGAATGGTCTCAACTTGCAGCCCCATTATACTAA[T/C]GATGATCTGAAGTTTCTCAAGCACGCAGAGAAACGTAAGAGAAACGTTCCAGCAAAGGGA,TCCCTTTGCTGGAACGTTTCTCTTACGTTTCTCTGCGTGCTTGAGAAACTTCAGATCATC[A/G]TTAGTATAATGGGGCTGCAAGTTGAGACCATTCCTATCAGCTATGGAGGTTTGTTTTTAC,1241
+        UA-IFASA-9813_dup-0_B_F_2329051538,UA-IFASA-9813,BOT,[T/C],0011661313,ACCTTTGCACTCGCTAACGGTTCAGCATTAATCAGACTTCCTCAGGAATT,,,3,19,32508700,diploid,Bos taurus,UM3,0,BOT,AATAAAACCAACCTTTGCACTCGCTAACGGTTCAGCATTAATCAGACTTCCTCAGGAATT[T/C]AGGGGTCAATTCCCCCATGTCTAAAATTGAACCTCAACGTCCTTTCTGTTTTCAAAACTC,GAGTTTTGAAAACAGAAAGGACGTTGAGGTTCAATTTTAGACATGGGGGAATTGACCCCT[A/G]AATTCCTGAGGAAGTCTGATTAATGCTGAACCGTTAGCGAGTGCAAAGGTTGGTTTTATT,1241
+        UMPS_dup-1_T_R_2327737250,UMPS,TOP,[A/G],0073777348,TAACTGAACTCCTGGAGTCAAGTGAAGAAATTCTGGTTTCATGCTTACTC,,,0,1,69756880,diploid,Bos taurus,UMD3.1,1,BOT,TCATCTGTTGATTACATTCCATTCAGGTGCAAATGGCTGAAGAACATTCTGAATTTGTGATTGGTTTTATTTCTGGCTCC[T/C]GAGTAAGCATGAAACCAGAATTTCTTCACTTGACTCCAGGAGTTCAGTTAGAAGCAGGAGGTAAGCCTATTGATTGGTAA,TTACCAATCAATAGGCTTACCTCCTGCTTCTAACTGAACTCCTGGAGTCAAGTGAAGAAATTCTGGTTTCATGCTTACTC[A/G]GGAGCCAGAAATAAAACCAATCACAAATTCAGAATGTTCTTCAGCCATTTGCACCTGAATGGAATGTAATCAACAGATGA,1241
+
+
 .. code-block:: python
 
     import pandas as pd
     from snplib.format import make_map
 
-    input_data = pd.read_csv(DIR_FILES / "./file_bovinesnp50.csv")
+    input_data = pd.read_csv("./file_bovinesnp50.csv")
     data_map = make_map(input_data)
 
 Output data view::
@@ -150,12 +275,6 @@ Output data view::
          0  BovineHD0100037703        0        0
          0  BovineHD0100037704        0        0
 
-.. note::
-    file_bovinesnp50.csv - The file that is taken on the Illumina website with full
-    information about the chip
-    https://support.illumina.com/downloads/bovinesnp50-v3-0-product-files.html
-
-
 **ped** - https://www.cog-genomics.org/plink/1.9/formats#ped
 
 .. code-block:: python

snplib-1.2.10/docs/requirements.txt

@@ -0,0 +1,2 @@
+sphinx==8.1.3
+sphinx_rtd_theme==3.0.2

{snplib-1.0.10 → snplib-1.2.10}/pyproject.toml

@@ -17,7 +17,7 @@ snplib = ["*.pl"]
 
 [project]
 name = "snplib"
-version = "1.0.10"
+version = "1.2.10"
 description = "Snptools is a tool for Single Nucleotide Polymorphism (SNP) data processing"
 authors = [
     {name = "Igor", email = "igor.loschinin@gmail.com"}
@@ -30,14 +30,14 @@ classifiers = [
     "Operating System :: OS Independent",
 ]
 dependencies = [
-    "numpy>=1.26.1",
-    "pandas>=2.1.1",
-    "six>=1.16.0",
+    "numpy>=2.2.3",
+    "pandas>=2.2.3",
+    "six>=1.17.0",
     "swifter>=1.4.0",
     "xlrd>=2.0.1",
-    "XlsxWriter>=3.1.9",
-    "openpyxl>=3.1.2",
-    "pydantic>=2.4.2",
+    "XlsxWriter>=3.2.2",
+    "openpyxl>=3.1.5",
+    "pydantic>=2.10.6",
 ]
 
 [project.urls]

snplib-1.2.10/requirements.txt

@@ -0,0 +1,10 @@
+numpy==2.2.3
+pandas==2.2.3
+six==1.17.0
+swifter==1.4.0
+xlrd==2.0.1
+XlsxWriter==3.2.2
+openpyxl==3.1.5
+pydantic==2.10.6
+pytest==8.3.4
+setuptools-scm==8.1.0

snplib-1.2.10/src/snplib/finalreport/_finalreport.py

@@ -0,0 +1,304 @@
+#!/usr/bin/env python
+# coding: utf-8
+__author__ = "Igor Loschinin (igor.loschinin@gmail.com)"
+__all__ = ("FinalReport",)
+
+import re
+from functools import reduce
+from pathlib import Path
+
+import pandas as pd
+from numpy import nan
+
+
+class FinalReport(object):
+	""" File that contains SNP information. File processing is triggered by the
+	handle method. If values in 'SID' or 'UNIQ_KEY' were missing in the xlsx
+	conversion file, the processed data will contain NAN values.
+
+	:param allele: A variant form of a single nucleotide polymorphism (SNP), a
+		specific polymorphic site or a whole gene detectable at a locus. Type:
+		'AB', 'Forward', 'Top', 'Plus', 'Design'.
+	:param sep: Delimiter to use. Default value: "\\t".
+	:param usecols: Selection of fields for reading. Accelerates processing
+		and reduces memory.
+	:param dtype: Data type(s) to apply to either the whole dataset or
+		individual columns. E.g., {'a': np.float64, 'b': np.int32, 'c': 'Int64'}.
+
+	Example:
+		[Header]
+		GSGT Version	2.0.4
+		Processing Date	10/14/2021 4:02 PM
+		Content		BovineSNP50_v3_A1.bpm
+		Num SNPs	53218
+		Total SNPs	53218
+		Num Samples	3
+		Total Samples	3
+		[Data]
+		SNP Name  Sample ID  Allele1 - AB  Allele2 - AB  GC Score  GT Score
+		ABCA12	1	A	A	0.4048	0.8164
+		APAF1	1	B	B	0.9067	0.9155
+		...
+	"""
+
+	__PATTERN_HEADER = re.compile(r'(^\[Header])')
+	__PATTERN_DATA = re.compile(r'(^\[Data])')
+
+	__slots__ = (
+		"_delimiter",
+		"__allele",
+		"__usecols",
+		"__dtype",
+		"__snp_data",
+		"__header",
+		"_map_rn",
+	)
+
+	def __init__(
+			self,
+			allele: str | list | None = None,
+			usecols: list[str] | None = None,
+			dtype: dict | None = None,
+			sep: str = "\t"
+	) -> None:
+		self._delimiter = sep
+		self.__allele = allele
+		self.__usecols = usecols
+		self.__dtype = dtype
+
+		# self._full_data = None
+		self.__snp_data: pd.DataFrame | None = None
+		self.__header = {}
+		self._map_rn = None
+
+	@property
+	def header(self) -> dict:
+		return self.__header
+
+	@property
+	def snp_data(self) -> pd.DataFrame | None:
+		return self.__snp_data
+
+	def handle(
+			self, file_rep: Path | str, conv_file: Path | str = None
+	) -> bool:
+		""" Processes the FinalReport.txt file. Highlights meta information
+		and data.
+
+		:param file_rep: The file FinalReport.txt or another name.
+		:param conv_file: The file that contains IDs of registration numbers
+			of animals.
+		:return: Returns true if file processing was successful, false if
+			there were errors.
+		"""
+
+		try:
+
+			if self.__allele is not None and self.__usecols is not None:
+				raise Exception("Error. Usecols is used for allele is none.")
+
+			if isinstance(file_rep, str):
+				file_rep = Path(file_rep)
+
+			if not file_rep.is_file() and not file_rep.exists():
+				return False
+
+			# Processing conversion file
+			if conv_file is not None:
+				if isinstance(conv_file, str):
+					conv_file = Path(conv_file)
+
+				if not conv_file.is_file() and not conv_file.exists():
+					return False
+
+				self.__convert_s_id(conv_file)
+
+			# # Processing report file
+			self.__handler_header(file_rep)
+			self.__handler_data(file_rep)
+
+			if not self.__snp_data.empty and self._map_rn is not None:
+				self.__snp_data['Sample ID'] = \
+					self.__snp_data['Sample ID'].map(
+						dict(zip(self._map_rn.SID, self._map_rn.UNIQ_KEY))
+					)
+
+		except Exception as e:
+			raise e
+
+		return True
+
+	def __handler_header(self, file_rep: Path) -> None:
+		""" Processes data from a file, selects meta-information.
+
+		:param file_rep: path, pointer to the file to be read.
+		"""
+
+		with open(file_rep, 'r') as file:
+
+			for line in file:
+				if self.__class__.__PATTERN_DATA.findall(line.strip()):
+					return
+
+				if self.__class__.__PATTERN_HEADER.findall(line.strip()) or\
+					len(line.strip()) == 0:
+					continue
+
+				key = line.strip().split("\t")[0]
+				value = line.strip().split("\t")[1]
+
+				self.__header[key] = value
+
+	def __handler_data(self, file_rep: Path) -> None:
+		""" Processes data and forms an array for further processing.
+
+		:param file_rep: path, pointer to the file to be read.
+		"""
+
+		with open(file_rep, 'r') as file:
+
+			# Search for the data start index and skip
+			for line in file:
+				if self.__class__.__PATTERN_DATA.findall(line.strip()):
+					break
+
+			# line column
+			orig_name_col = file.readline().strip().split(self._delimiter)
+
+			if self.__allele is None and self.__usecols is None:
+				self.__snp_data = pd.read_csv(
+					file,
+					sep=self._delimiter,
+					header=None,
+					names=orig_name_col,
+					dtype=self.__dtype,
+					low_memory=True,
+					na_filter=True
+				)
+
+				return
+
+			sub_n_col = self.__processing_columns(orig_name_col)
+			self.__snp_data = pd.read_csv(
+				file,
+				sep=self._delimiter,
+				header=None,
+				names=orig_name_col,
+				usecols=sub_n_col,
+				dtype=self.__dtype,
+				low_memory=True,
+				na_filter=True
+			)
+
+			return
+
+	def __processing_columns(self, lst_col: list[str]) -> list[str] | None:
+		""" Processing the line with all the names of the fields and the
+		sample of them.
+
+		:param lst_col: List of all fields.
+		:return: Returns a tuple with a list of names of selected fields.
+		"""
+
+		if self.__usecols is not None:
+			check_n_col = [
+				item for item in self.__usecols if item in lst_col
+			]
+
+			# Check on empty list
+			if check_n_col:
+				return self.__usecols
+
+			raise Exception(
+				f"Error. The USECOLS list contains not true fields."
+			)
+
+		# processing alleles
+		sample_n_col = self.__sample_by_allele(lst_col)
+		if sample_n_col is None:
+			raise Exception(
+				f"Error. Allele {self.__allele} not in data."
+			)
+
+		return sample_n_col
+
+	def __sample_by_allele(self, names: list[str]) -> list[str] | None:
+		""" Method that generates a list of field names choosing which alleles
+		to keep
+
+		:param names: List of field names in the report file.
+		:return: Returns a filtered list of fields by alleles.
+		"""
+
+		allele_templ = r'(^Allele\d\s[:-]\s{}\b)'
+
+		match self.__allele:
+			case None:
+				return names
+
+			case str():
+				allele_pattern = re.compile(
+					allele_templ.format(self.__allele)
+				)
+
+			case list() | tuple() | set():
+				allele_pattern = re.compile(
+					allele_templ.format("|".join(self.__allele))
+				)
+			case _:
+				return None
+
+		lst_allele = reduce(
+			lambda i, j: i + j,
+			[allele_pattern.findall(item) for item in names]
+		)
+
+		if len(lst_allele) == 0:
+			return None
+
+		exclude_alleles = [
+			item for item in names
+			if item.startswith("Allele") and item not in lst_allele
+		]
+
+		return list(filter(
+			lambda x: True if x not in exclude_alleles else False, names
+		))
+
+	def __convert_s_id(self, path_file: Path) -> None:
+		"""Converts sample id which is in FinalReport to animal registration
+		number.
+
+		:param path_file: xlsx file with animal numbers label
+		"""
+
+		self._map_rn = pd.read_excel(
+			path_file,
+			header=None,
+			names=['SID', 'UNIQ_KEY', 'SEX'],
+			dtype={'SID': str},
+			index_col=False
+		)
+
+		if self._map_rn.empty:
+			self._map_rn = None
+			return
+
+		self._map_rn.SID = self._map_rn.SID.str.strip()
+		self._map_rn.UNIQ_KEY = self._map_rn.UNIQ_KEY.str.strip()
+
+		if self._check_on_ru_symbols(self._map_rn.UNIQ_KEY):
+			raise Exception("Error. Unique keys contain Cyrillic alphabet.")
+
+	@staticmethod
+	def _check_on_ru_symbols(seq: pd.Series) -> bool | None:
+		""" Checial verification of the Cyrillic
+
+		:param seq: Squeezed for verification.
+		:return: Truth if there are no symbols of Cyril and there is a lie if
+			there is.
+		"""
+
+		return seq.apply(
+			lambda x: bool(re.search('[а-яА-Я]', x)) if x is not nan else x
+		).any()

{snplib-1.0.10 → snplib-1.2.10/src/snplib.egg-info}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.2
 Name: snplib
-Version: 1.0.10
+Version: 1.2.10
 Summary: Snptools is a tool for Single Nucleotide Polymorphism (SNP) data processing
 Author-email: Igor <igor.loschinin@gmail.com>
 License: GNU
@@ -10,14 +10,14 @@ Classifier: Operating System :: OS Independent
 Requires-Python: >=3.10
 Description-Content-Type: text/markdown
 License-File: LICENSE
-Requires-Dist: numpy>=1.26.1
-Requires-Dist: pandas>=2.1.1
-Requires-Dist: six>=1.16.0
+Requires-Dist: numpy>=2.2.3
+Requires-Dist: pandas>=2.2.3
+Requires-Dist: six>=1.17.0
 Requires-Dist: swifter>=1.4.0
 Requires-Dist: xlrd>=2.0.1
-Requires-Dist: XlsxWriter>=3.1.9
-Requires-Dist: openpyxl>=3.1.2
-Requires-Dist: pydantic>=2.4.2
+Requires-Dist: XlsxWriter>=3.2.2
+Requires-Dist: openpyxl>=3.1.5
+Requires-Dist: pydantic>=2.10.6
 
 # snptools
 <p align="center">

{snplib-1.0.10 → snplib-1.2.10}/src/snplib.egg-info/SOURCES.txt

@@ -63,6 +63,10 @@ tests/finalreport/files/fr/file6.txt
 tests/finalreport/files/fr/file6.xlsx
 tests/finalreport/files/fr/file7.txt
 tests/finalreport/files/fr/file7.xlsx
+tests/finalreport/files/fr/file8.txt
+tests/finalreport/files/fr/file8.xlsx
+tests/finalreport/files/fr/file9.txt
+tests/finalreport/files/fr/file9.xlsx
 tests/format/__init__.py
 tests/format/test_plink_fam.py
 tests/format/test_plink_lgen.py

snplib-1.2.10/src/snplib.egg-info/requires.txt

@@ -0,0 +1,8 @@
+numpy>=2.2.3
+pandas>=2.2.3
+six>=1.17.0
+swifter>=1.4.0
+xlrd>=2.0.1
+XlsxWriter>=3.2.2
+openpyxl>=3.1.5
+pydantic>=2.10.6

snplib-1.2.10/tests/finalreport/files/fr/file8.txt

@@ -0,0 +1,28 @@
+[Header]
+GSGT Version	2.0.4
+Processing Date	10/14/2021 4:02 PM
+Content		BovineSNP50_v3_A1.bpm
+Num SNPs	53218
+Total SNPs	53218
+Num Samples	3
+Total Samples	3
+[Data]
+SNP Name	Sample ID	Allele1 - AB	Allele2 - AB	GC Score	GT Score
+ABCA12	1	A	A	0.4048	0.8164
+APAF1	1	B	B	0.9067	0.9155
+ARS-BFGL-BAC-10172	1	B	B	0.9140	0.8767
+ARS-BFGL-BAC-1020	1	B	B	0.9288	0.8919
+ARS-BFGL-BAC-10245	1	B	B	0.7227	0.7447
+ARS-BFGL-BAC-10345	1	A	B	0.9468	0.9127
+ABCA12	2	A	A	0.4048	0.8164
+APAF1	2	B	B	0.9067	0.9155
+ARS-BFGL-BAC-10172	2	A	B	0.9140	0.8767
+ARS-BFGL-BAC-1020	2	A	B	0.9288	0.8919
+ARS-BFGL-BAC-10245	2	A	A	0.7227	0.7447
+ARS-BFGL-BAC-10345	2	B	B	0.9468	0.9127
+ABCA12	3	A	A	0.4048	0.8164
+APAF1	3	B	B	0.9067	0.9155
+ARS-BFGL-BAC-10172	3	A	B	0.9140	0.8767
+ARS-BFGL-BAC-1020	3	A	B	0.9288	0.8919
+ARS-BFGL-BAC-10245	3	A	A	0.7227	0.7447
+ARS-BFGL-BAC-10345	3	A	B	0.9468	0.9127