samplesheet-parser 0.3.0__tar.gz → 0.3.2__tar.gz

samplesheet_parser-0.3.2/.zenodo.json

@@ -0,0 +1,30 @@
+{
+  "title": "samplesheet-parser: A Python library for parsing, validating, converting, and merging Illumina SampleSheet V1 and V2 files",
+  "description": "Open-source Python library providing format auto-detection, bidirectional V1/V2 conversion, structural and index validation, sheet diffing, and cross-project merging for Illumina SampleSheet files.",
+  "upload_type": "software",
+  "access_right": "open",
+  "license": "Apache-2.0",
+  "version": "0.3.1",
+  "keywords": [
+    "bioinformatics", "Illumina", "SampleSheet", "BCLConvert",
+    "demultiplexing", "genomics", "sequencing", "Python"
+  ],
+  "creators": [
+    {
+      "name": "Kasaraneni, Chaitanya Krishna",
+      "orcid": "0000-0001-5792-1095"
+    }
+  ],
+  "related_identifiers": [
+    {
+      "identifier": "https://github.com/chaitanyakasaraneni/samplesheet-parser",
+      "relation": "isSupplementTo",
+      "scheme": "url"
+    },
+    {
+      "identifier": "https://pypi.org/project/samplesheet-parser/",
+      "relation": "isIdenticalTo",
+      "scheme": "url"
+    }
+  ]
+}

{samplesheet_parser-0.3.0 → samplesheet_parser-0.3.2}/CHANGELOG.md

@@ -6,6 +6,82 @@ The format follows [Keep a Changelog](https://keepachangelog.com/en/1.0.0/).
 
 ---
 
+## [0.3.2] - 2026-03-12
+
+### Added
+- `.zenodo.json` metadata file for automatic Zenodo archival and DOI
+  minting on GitHub releases
+- `CITATION.cff` file enabling GitHub's "Cite this repository" button
+  and standardized software citation for downstream users
+
+## [0.3.1] - 2026-03-11
+
+### Fixed
+
+- **`SampleSheetMerger`** — `INDEX_DISTANCE_TOO_LOW` and `DUPLICATE_INDEX`
+  were reported twice in `--force` merges (once by the pre-merge cross-sheet
+  check, once by the post-merge validator). Duplicate codes are now suppressed
+  in `_validate_merged` — the more descriptive pre-merge message is always
+  preferred.
+
+## [0.3.0] - 2026-03-10
+
+### Added
+
+- **`SampleSheetMerger`** — combines multiple per-project sample sheets into a
+  single sheet for a flow cell run.
+  - `add(path)` — register an input sheet (V1 or V2); mixed formats are
+    auto-converted to the target version before merging.
+  - `merge(output_path, validate=True, abort_on_conflicts=True)` — merges all
+    registered sheets, writes the combined output, and returns a `MergeResult`.
+  - **Index collision detection** — raises a conflict when two samples share
+    the same lane and index sequence across project boundaries.
+  - **Hamming distance check** — warns when the combined I7+I5 distance between
+    any two samples across sheets falls below 3.
+  - **Read-length conflict detection** — raises a conflict when registered
+    sheets specify incompatible `Read1Cycles`/`Read2Cycles` (V2) or `[Reads]`
+    lengths (V1).
+  - **Adapter conflict detection** — warns when adapter sequences differ across
+    sheets.
+  - **Mixed-format warning** — emits a warning when V1 and V2 sheets are
+    combined, with the auto-conversion strategy logged.
+  - `MergeResult` dataclass — exposes `conflicts`, `warnings`, `sample_count`,
+    `source_versions`, `output_path`, `has_conflicts`, and `summary()`;
+    consistent with `ValidationResult` and `DiffResult`.
+  - `abort_on_conflicts=True` (default) — skips writing the output file when
+    any conflict is present; set `False` (via `--force` in the CLI) to write
+    despite conflicts.
+  - `SampleSheetMerger` and `MergeResult` are exported from the top-level
+    package.
+
+- **`samplesheet` CLI** — command-line interface exposing the four core
+  operations, available as an optional extra (`pip install
+  "samplesheet-parser[cli]"`; adds `typer` as a dependency).
+  - `samplesheet validate <file>` — exits 0 if clean, 1 if errors, 2 on
+    usage/parse errors. Supports `--format json` for machine-readable output.
+  - `samplesheet convert <file> --to <v1|v2> --output <path>` — converts
+    between formats; exits 0 on success, 1 on conversion error, 2 on bad
+    arguments.
+  - `samplesheet diff <old> <new>` — exits 0 if identical, 1 if differences
+    detected (useful in CI pre-run checks). Supports `--format json`.
+  - `samplesheet merge <files...> --output <path>` — merges two or more sheets;
+    exits 0 on clean merge, 1 on conflicts or warnings, 2 on bad arguments.
+    Supports `--force`, `--to <v1|v2>`, and `--format json`.
+  - All commands print errors to stderr and structured data to stdout.
+  - Entry point configured in `pyproject.toml`:
+    `samplesheet = "samplesheet_parser.cli:main"`.
+  - Module imports cleanly without `typer` installed — missing-extra error is
+    surfaced only at invocation time.
+
+### Changed
+
+- README updated to document `SampleSheetMerger`, the `samplesheet` CLI, all
+  new API reference tables, and installation instructions for the `[cli]` extra.
+- `CONTRIBUTING.md` updated with CLI testing instructions and the new
+  `[dev,cli]` install target.
+
+---
+
 ## [0.2.0] - 2026-02-25
 
 ### Added

samplesheet_parser-0.3.2/CITATION.cff

@@ -0,0 +1,25 @@
+cff-version: 1.2.0
+message: "If you use this software, please cite it as below."
+type: software
+title: "samplesheet-parser"
+version: 0.3.2
+date-released: 2026-03-12
+license: Apache-2.0
+url: "https://github.com/chaitanyakasaraneni/samplesheet-parser"
+repository-code: "https://github.com/chaitanyakasaraneni/samplesheet-parser"
+abstract: >
+  A Python library for parsing, validating, converting, and merging
+  Illumina SampleSheet V1 and V2 files for BCLConvert and bcl2fastq.
+keywords:
+  - bioinformatics
+  - Illumina
+  - SampleSheet
+  - BCLConvert
+  - demultiplexing
+  - genomics
+  - Python
+authors:
+  - family-names: Kasaraneni
+    given-names: Chaitanya Krishna
+    email: kc.kasaraneni@gmail.com
+    orcid: "https://orcid.org/0000-0001-5792-1095"

{samplesheet_parser-0.3.0 → samplesheet_parser-0.3.2}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: samplesheet-parser
-Version: 0.3.0
+Version: 0.3.2
 Summary: Format-agnostic parser for Illumina SampleSheet.csv files — supports IEM V1 and BCLConvert V2
 Project-URL: Homepage, https://github.com/chaitanyakasaraneni/samplesheet-parser
 Project-URL: Documentation, https://illumina-samplesheet.readthedocs.io
@@ -584,7 +584,7 @@ See [CONTRIBUTING.md](CONTRIBUTING.md) for the full local testing guide and PR c
   title   = {samplesheet-parser: Format-agnostic parser for Illumina SampleSheet.csv},
   year    = {2026},
   url     = {https://github.com/chaitanyakasaraneni/samplesheet-parser},
-  version = {0.3.0}
+  version = {0.3.2}
 }
 ```
 

{samplesheet_parser-0.3.0 → samplesheet_parser-0.3.2}/README.md

@@ -533,7 +533,7 @@ See [CONTRIBUTING.md](CONTRIBUTING.md) for the full local testing guide and PR c
   title   = {samplesheet-parser: Format-agnostic parser for Illumina SampleSheet.csv},
   year    = {2026},
   url     = {https://github.com/chaitanyakasaraneni/samplesheet-parser},
-  version = {0.3.0}
+  version = {0.3.2}
 }
 ```
 

samplesheet_parser-0.3.2/examples/demo_merger.py

@@ -0,0 +1,130 @@
+"""
+demo_merger.py — SampleSheetMerger usage examples.
+
+Demonstrates three scenarios:
+
+    1. Clean merge     — two V1 sheets, no conflicts, output written.
+    2. Mixed formats   — V1 + V1 + V2, auto-converted to a target version.
+    3. Conflict handling — index collision detected; abort vs. force write.
+
+Run from the repo root::
+
+    python examples/demo_merger.py
+
+Sample sheets used are in examples/samplesheets/.
+"""
+
+from __future__ import annotations
+
+from pathlib import Path
+
+from samplesheet_parser import MergeResult, SampleSheetMerger
+from samplesheet_parser.enums import SampleSheetVersion
+
+SHEETS = Path(__file__).parent / "sample_sheets"
+
+
+def print_result(result: MergeResult) -> None:
+    print(f"  Summary      : {result.summary()}")
+    print(f"  Sample count : {result.sample_count}")
+    print(f"  Has conflicts: {result.has_conflicts}")
+    print(f"  Output path  : {result.output_path}")
+    if result.warnings:
+        print("  Warnings:")
+        for w in result.warnings:
+            print(f"    [{w.code}] {w.message}")
+    if result.conflicts:
+        print("  Conflicts:")
+        for c in result.conflicts:
+            print(f"    [{c.code}] {c.message}")
+
+
+# ---------------------------------------------------------------------------
+# Scenario 1: Clean merge — two V1 sheets → combined V2
+# ---------------------------------------------------------------------------
+
+print("=" * 60)
+print("Scenario 1: Clean merge (V1 + V1 → V2)")
+print("=" * 60)
+
+merger = SampleSheetMerger(target_version=SampleSheetVersion.V2)
+merger.add(SHEETS / "ProjectAlpha_SampleSheet.csv")
+merger.add(SHEETS / "ProjectBeta_SampleSheet.csv")
+
+result = merger.merge(
+    SHEETS / "combined_clean.csv",
+    validate=True,
+    abort_on_conflicts=True,
+)
+
+print_result(result)
+print()
+
+# ---------------------------------------------------------------------------
+# Scenario 2: Mixed formats — V1 + V1 + V2 → combined V2
+# ProjectGamma supplies a V2 sheet; merger auto-converts all inputs to V2.
+# Mixed-format inputs produce a warning but are not a conflict.
+# ---------------------------------------------------------------------------
+
+print("=" * 60)
+print("Scenario 2: Mixed formats (V1 + V1 + V2 → V2)")
+print("=" * 60)
+
+merger = SampleSheetMerger(target_version=SampleSheetVersion.V2)
+merger.add(SHEETS / "ProjectAlpha_SampleSheet.csv")
+merger.add(SHEETS / "ProjectBeta_SampleSheet.csv")
+merger.add(SHEETS / "ProjectGamma_SampleSheet.csv")
+
+result = merger.merge(
+    SHEETS / "combined_mixed_formats.csv",
+    validate=True,
+    abort_on_conflicts=True,
+)
+
+print_result(result)
+print()
+
+# ---------------------------------------------------------------------------
+# Scenario 3a: Index collision — abort_on_conflicts=True (default)
+# ProjectDelta reuses an index from ProjectAlpha on the same lane.
+# The output file is NOT written; result.output_path is None.
+# ---------------------------------------------------------------------------
+
+print("=" * 60)
+print("Scenario 3a: Index collision — abort (default)")
+print("=" * 60)
+
+merger = SampleSheetMerger(target_version=SampleSheetVersion.V2)
+merger.add(SHEETS / "ProjectAlpha_SampleSheet.csv")
+merger.add(SHEETS / "ProjectDelta_SampleSheet_collision.csv")
+
+result = merger.merge(
+    SHEETS / "combined_collision_aborted.csv",
+    validate=True,
+    abort_on_conflicts=True,   # default — file not written on conflict
+)
+
+print_result(result)
+print()
+
+# ---------------------------------------------------------------------------
+# Scenario 3b: Index collision — abort_on_conflicts=False (force write)
+# Same collision as above, but the file is written anyway.
+# Equivalent to passing --force on the CLI.
+# ---------------------------------------------------------------------------
+
+print("=" * 60)
+print("Scenario 3b: Index collision — force write")
+print("=" * 60)
+
+merger = SampleSheetMerger(target_version=SampleSheetVersion.V2)
+merger.add(SHEETS / "ProjectAlpha_SampleSheet.csv")
+merger.add(SHEETS / "ProjectDelta_SampleSheet_collision.csv")
+
+result = merger.merge(
+    SHEETS / "combined_collision_forced.csv",
+    validate=True,
+    abort_on_conflicts=False,   # write despite conflicts
+)
+
+print_result(result)

samplesheet_parser-0.3.2/examples/sample_sheets/ProjectAlpha_SampleSheet.csv

@@ -0,0 +1,25 @@
+[Header]
+IEMFileVersion,5
+Experiment Name,240115_A01234_0042_AHJLG7DRXX
+Date,2024-01-15
+Workflow,GenerateFASTQ
+Application,FASTQ Only
+Instrument Type,NovaSeq 6000
+Assay,TruSeq DNA PCR-Free
+Index Adapters,TruSeq DNA UD Indexes (96 Indexes)
+Chemistry,Amplicon
+
+[Reads]
+151
+151
+
+[Settings]
+ReverseComplement,0
+Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
+AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+
+[Data]
+Lane,Sample_ID,Sample_Name,Sample_Plate,Sample_Well,I7_Index_ID,index,I5_Index_ID,index2,Sample_Project,Description
+1,AlphaSample1,AlphaSample1,,A01,UDP0001,CAAGACAGAT,UDP0001,ACTATAGCCT,ProjectAlpha,WGS_batch1
+1,AlphaSample2,AlphaSample2,,B01,UDP0002,TGAACCTGAT,UDP0002,TGATACGTCC,ProjectAlpha,WGS_batch1
+1,AlphaSample3,AlphaSample3,,C01,UDP0003,GCACAACGTT,UDP0003,CATCTCACAG,ProjectAlpha,WGS_batch1

samplesheet_parser-0.3.2/examples/sample_sheets/ProjectBeta_SampleSheet.csv

@@ -0,0 +1,25 @@
+[Header]
+IEMFileVersion,5
+Experiment Name,240115_A01234_0042_AHJLG7DRXX
+Date,2024-01-15
+Workflow,GenerateFASTQ
+Application,FASTQ Only
+Instrument Type,NovaSeq 6000
+Assay,TruSeq DNA PCR-Free
+Index Adapters,TruSeq DNA UD Indexes (96 Indexes)
+Chemistry,Amplicon
+
+[Reads]
+151
+151
+
+[Settings]
+ReverseComplement,0
+Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
+AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+
+[Data]
+Lane,Sample_ID,Sample_Name,Sample_Plate,Sample_Well,I7_Index_ID,index,I5_Index_ID,index2,Sample_Project,Description
+1,BetaSample1,BetaSample1,,D01,UDP0004,ATCGCCTGTT,UDP0004,GACTAGCATG,ProjectBeta,WGS_batch2
+1,BetaSample2,BetaSample2,,E01,UDP0005,CTTGTAGCAA,UDP0005,TGCGTCAGCC,ProjectBeta,WGS_batch2
+1,BetaSample3,BetaSample3,,F01,UDP0006,GCGCGATGTT,UDP0006,CTATGCCGGT,ProjectBeta,WGS_batch2

samplesheet_parser-0.3.2/examples/sample_sheets/ProjectDelta_SampleSheet_collision.csv

@@ -0,0 +1,24 @@
+[Header]
+IEMFileVersion,5
+Experiment Name,240115_A01234_0042_AHJLG7DRXX
+Date,2024-01-15
+Workflow,GenerateFASTQ
+Application,FASTQ Only
+Instrument Type,NovaSeq 6000
+Assay,TruSeq DNA PCR-Free
+Index Adapters,TruSeq DNA UD Indexes (96 Indexes)
+Chemistry,Amplicon
+
+[Reads]
+151
+151
+
+[Settings]
+ReverseComplement,0
+Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
+AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+
+[Data]
+Lane,Sample_ID,Sample_Name,Sample_Plate,Sample_Well,I7_Index_ID,index,I5_Index_ID,index2,Sample_Project,Description
+1,DeltaSample1,DeltaSample1,,G01,UDP0001,CAAGACAGAT,UDP0001,ACTATAGCCT,ProjectDelta,WGS_batch3
+1,DeltaSample2,DeltaSample2,,H01,UDP0009,AGTAAGCCGT,UDP0009,TTCCTGCAGT,ProjectDelta,WGS_batch3

samplesheet_parser-0.3.2/examples/sample_sheets/ProjectGamma_SampleSheet.csv

@@ -0,0 +1,21 @@
+[Header]
+FileFormatVersion,2
+RunName,240115_A01234_0042_AHJLG7DRXX
+InstrumentPlatform,NovaSeqXSeries
+
+[Reads]
+Read1Cycles,151
+Read2Cycles,151
+Index1Cycles,10
+Index2Cycles,10
+
+[BCLConvert_Settings]
+SoftwareVersion,3.9.3
+AdapterRead1,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
+AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+
+[BCLConvert_Data]
+Lane,Sample_ID,Sample_Name,Index,Index2,Sample_Project
+1,GammaSample1,GammaSample1,TCCGCGAAGT,TCAGCCTTGT,ProjectGamma
+1,GammaSample2,GammaSample2,AATGTTGCGT,GCAGCCTATT,ProjectGamma
+1,GammaSample3,GammaSample3,GTTCCGTGAT,AGTCCTAGGT,ProjectGamma

samplesheet_parser-0.3.2/examples/sample_sheets/combined_clean.csv

@@ -0,0 +1,20 @@
+[Header]
+FileFormatVersion,2
+RunName,240115_A01234_0042_AHJLG7DRXX
+
+[Reads]
+Read1Cycles,151
+Read2Cycles,151
+
+[BCLConvert_Settings]
+AdapterRead1,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
+AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+
+[BCLConvert_Data]
+Lane,Sample_ID,Index,Index2,Sample_Project
+1,AlphaSample1,CAAGACAGAT,ACTATAGCCT,ProjectAlpha
+1,AlphaSample2,TGAACCTGAT,TGATACGTCC,ProjectAlpha
+1,AlphaSample3,GCACAACGTT,CATCTCACAG,ProjectAlpha
+1,BetaSample1,ATCGCCTGTT,GACTAGCATG,ProjectBeta
+1,BetaSample2,CTTGTAGCAA,TGCGTCAGCC,ProjectBeta
+1,BetaSample3,GCGCGATGTT,CTATGCCGGT,ProjectBeta

samplesheet_parser-0.3.2/examples/sample_sheets/combined_collision_forced.csv

@@ -0,0 +1,19 @@
+[Header]
+FileFormatVersion,2
+RunName,240115_A01234_0042_AHJLG7DRXX
+
+[Reads]
+Read1Cycles,151
+Read2Cycles,151
+
+[BCLConvert_Settings]
+AdapterRead1,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
+AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+
+[BCLConvert_Data]
+Lane,Sample_ID,Index,Index2,Sample_Project
+1,AlphaSample1,CAAGACAGAT,ACTATAGCCT,ProjectAlpha
+1,AlphaSample2,TGAACCTGAT,TGATACGTCC,ProjectAlpha
+1,AlphaSample3,GCACAACGTT,CATCTCACAG,ProjectAlpha
+1,DeltaSample1,CAAGACAGAT,ACTATAGCCT,ProjectDelta
+1,DeltaSample2,AGTAAGCCGT,TTCCTGCAGT,ProjectDelta

samplesheet_parser-0.3.2/examples/sample_sheets/combined_mixed_formats.csv

@@ -0,0 +1,23 @@
+[Header]
+FileFormatVersion,2
+RunName,240115_A01234_0042_AHJLG7DRXX
+
+[Reads]
+Read1Cycles,151
+Read2Cycles,151
+
+[BCLConvert_Settings]
+AdapterRead1,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
+AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+
+[BCLConvert_Data]
+Lane,Sample_ID,Index,Index2,Sample_Project
+1,AlphaSample1,CAAGACAGAT,ACTATAGCCT,ProjectAlpha
+1,AlphaSample2,TGAACCTGAT,TGATACGTCC,ProjectAlpha
+1,AlphaSample3,GCACAACGTT,CATCTCACAG,ProjectAlpha
+1,BetaSample1,ATCGCCTGTT,GACTAGCATG,ProjectBeta
+1,BetaSample2,CTTGTAGCAA,TGCGTCAGCC,ProjectBeta
+1,BetaSample3,GCGCGATGTT,CTATGCCGGT,ProjectBeta
+1,GammaSample1,TCCGCGAAGT,TCAGCCTTGT,ProjectGamma
+1,GammaSample2,AATGTTGCGT,GCAGCCTATT,ProjectGamma
+1,GammaSample3,GTTCCGTGAT,AGTCCTAGGT,ProjectGamma

{samplesheet_parser-0.3.0 → samplesheet_parser-0.3.2}/pyproject.toml

@@ -4,7 +4,7 @@ build-backend = "hatchling.build"
 
 [project]
 name = "samplesheet-parser"
-version = "0.3.0"
+version = "0.3.2"
 description = "Format-agnostic parser for Illumina SampleSheet.csv files — supports IEM V1 and BCLConvert V2"
 readme = "README.md"
 license = { file = "LICENSE" }

{samplesheet_parser-0.3.0 → samplesheet_parser-0.3.2}/samplesheet_parser/merger.py

@@ -122,6 +122,24 @@ class MergeResult:
         )
 
 
+# ---------------------------------------------------------------------------
+# Codes emitted by the cross-sheet pre-merge checks.
+# These are deduplicated against post-merge validator output in
+# _validate_merged() so the same issue is never reported twice.
+# ---------------------------------------------------------------------------
+
+# Validator codes that are fully covered by a pre-merge cross-sheet check
+# and must be suppressed in _validate_merged() to avoid duplicate reporting.
+_PRE_MERGE_CONFLICT_CODES: frozenset[str] = frozenset({
+    "INDEX_COLLISION",   # covered by _check_index_collisions
+    "DUPLICATE_INDEX",   # same root cause — validator sees result of collision
+})
+
+_PRE_MERGE_WARNING_CODES: frozenset[str] = frozenset({
+    "INDEX_DISTANCE_TOO_LOW",  # covered by _check_index_distances
+})
+
+
 # ---------------------------------------------------------------------------
 # Merger
 # ---------------------------------------------------------------------------
@@ -648,7 +666,15 @@ class SampleSheetMerger:
         writer: Any,
         result: MergeResult,
     ) -> None:
-        """Run SampleSheetValidator on the merged writer content."""
+        """Run SampleSheetValidator on the merged writer content.
+
+        Codes already reported by the pre-merge cross-sheet checks
+        (``_PRE_MERGE_CONFLICT_CODES`` / ``_PRE_MERGE_WARNING_CODES``) are
+        suppressed here to avoid duplicate reporting in the final
+        ``MergeResult``.  The pre-merge messages are more descriptive (they
+        include source file names and sample IDs) so they are always
+        preferred over the generic post-merge validator output.
+        """
         import tempfile
 
         content = writer.to_string()
@@ -677,7 +703,19 @@ class SampleSheetMerger:
             Path(tmp_path).unlink(missing_ok=True)
 
         for w in vresult.warnings:
+            if w.code in _PRE_MERGE_WARNING_CODES:
+                logger.debug(
+                    f"Suppressing duplicate post-merge warning {w.code!r} "
+                    "(already reported by pre-merge cross-sheet check)."
+                )
+                continue
             result.add_warning(w.code, w.message, **w.context)
 
         for e in vresult.errors:
+            if e.code in _PRE_MERGE_CONFLICT_CODES:
+                logger.debug(
+                    f"Suppressing duplicate post-merge conflict {e.code!r} "
+                    "(already reported by pre-merge cross-sheet check)."
+                )
+                continue
             result.add_conflict(e.code, e.message, **e.context)