opencloning 0.2.7.2__tar.gz → 0.2.8__tar.gz

{opencloning-0.2.7.2 → opencloning-0.2.8}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.3
 Name: opencloning
-Version: 0.2.7.2
+Version: 0.2.8
 Summary: Backend of OpenCloning, a web application to generate molecular cloning strategies in json format, and share them with others.
 License: MIT
 Author: Manuel Lera-Ramirez
@@ -15,7 +15,7 @@ Requires-Dist: beautifulsoup4 (>=4.11.1,<5.0.0)
 Requires-Dist: biopython (==1.84)
 Requires-Dist: fastapi
 Requires-Dist: httpx (>=0.25.0,<0.26.0)
-Requires-Dist: opencloning-linkml (==0.2.5.2a0)
+Requires-Dist: opencloning-linkml (==0.2.6a0)
 Requires-Dist: openpyxl (>=3.1.5,<4.0.0)
 Requires-Dist: pandas (>=2.2.3,<3.0.0)
 Requires-Dist: primer3-py (>=2.0.3,<3.0.0)

{opencloning-0.2.7.2 → opencloning-0.2.8}/pyproject.toml

@@ -3,7 +3,7 @@ authors = ["Manuel Lera-Ramirez <manulera14@gmail.com>"]
 description = "Backend of OpenCloning, a web application to generate molecular cloning strategies in json format, and share them with others."
 license = "MIT"
 name = "opencloning"
-version = "v0.2.7.2"
+version = "v0.2.8"
 package-mode = true
 readme = "README.md"
 repository = "https://github.com/manulera/OpenCloning_backend"
@@ -22,7 +22,7 @@ pydantic = "^2.7.1"
 pandas = "^2.2.3"
 openpyxl = "^3.1.5"
 pyyaml = "^6.0.2"
-opencloning-linkml = "0.2.5.2a0"
+opencloning-linkml = "0.2.6a0"
 primer3-py = "^2.0.3"
 biopython = "1.84"
 

opencloning-0.2.8/src/opencloning/cre_lox.py

@@ -0,0 +1,29 @@
+from itertools import product
+from pydna.dseqrecord import Dseqrecord
+
+from .dna_utils import compute_regex_site, dseqrecord_finditer
+
+# This is the original loxP sequence, here for reference
+LOXP_SEQUENCE = 'ATAACTTCGTATAGCATACATTATACGAAGTTAT'
+
+# This is a consensus sequence, from this Addgene blog post: https://blog.addgene.org/plasmids-101-cre-lox
+# IMPORTANT: Because it is palyndromic, we only look for it in the forward direction, if this was changed
+# to a non-palindromic sequence, you would need to look for matches reversing it, like in Gateway cloning
+LOXP_CONSENSUS = 'ATAACTTCGTATANNNTANNNTATACGAAGTTAT'
+
+
+loxP_regex = compute_regex_site(LOXP_CONSENSUS)
+
+
+def cre_loxP_overlap(x: Dseqrecord, y: Dseqrecord, _l: None = None) -> list[tuple[int, int, int]]:
+    """Find matching loxP sites between two sequences."""
+    out = list()
+    matches_x = dseqrecord_finditer(loxP_regex, x)
+    matches_y = dseqrecord_finditer(loxP_regex, y)
+
+    for match_x, match_y in product(matches_x, matches_y):
+        value_x = match_x.group()
+        value_y = match_y.group()
+        if value_x == value_y:
+            out.append((match_x.start(), match_y.start(), len(value_x)))
+    return out

{opencloning-0.2.7.2 → opencloning-0.2.8}/src/opencloning/dna_utils.py

@@ -11,9 +11,15 @@ import os
 import shutil
 from pydna.parsers import parse
 from Bio.Align import PairwiseAligner
+from Bio.Data.IUPACData import ambiguous_dna_values as _ambiguous_dna_values
+import re
 
 aligner = PairwiseAligner(scoring='blastn')
 
+ambiguous_only_dna_values = {**_ambiguous_dna_values}
+for normal_base in 'ACGT':
+    del ambiguous_only_dna_values[normal_base]
+
 
 def sum_is_sticky(three_prime_end: tuple[str, str], five_prime_end: tuple[str, str], partial: bool = False) -> int:
     """Return the overlap length if the 3' end of seq1 and 5' end of seq2 ends are sticky and compatible for ligation.
@@ -144,3 +150,20 @@ def align_sanger_traces(dseqr: Dseqrecord, sanger_traces: list[str]) -> list[str
         sanger_traces = traces_oriented
 
     return align_with_mafft([query_str, *sanger_traces], True)
+
+
+def compute_regex_site(site: str) -> str:
+    upper_site = site.upper()
+    for k, v in ambiguous_only_dna_values.items():
+        if len(v) > 1:
+            upper_site = upper_site.replace(k, f"[{''.join(v)}]")
+
+    # Make case insensitive
+    upper_site = f'(?i){upper_site}'
+    return upper_site
+
+
+def dseqrecord_finditer(pattern: str, seq: Dseqrecord) -> list[re.Match]:
+    query = str(seq.seq) if not seq.circular else str(seq.seq) * 2
+    matches = re.finditer(pattern, query)
+    return (m for m in matches if m.start() <= len(seq))

{opencloning-0.2.7.2 → opencloning-0.2.8}/src/opencloning/endpoints/assembly.py

@@ -5,7 +5,7 @@ from pydna.primer import Primer as PydnaPrimer
 from pydna.crispr import cas9
 from pydantic import conlist, create_model
 from Bio.Restriction.Restriction import RestrictionBatch
-
+from opencloning.cre_lox import cre_loxP_overlap
 from ..dna_functions import (
     get_invalid_enzyme_names,
     format_sequence_genbank,
@@ -24,6 +24,8 @@ from ..pydantic_models import (
     AssemblySource,
     OverlapExtensionPCRLigationSource,
     GatewaySource,
+    CreLoxRecombinationSource,
+    InVivoAssemblySource,
 )
 from ..assembly2 import (
     Assembly,
@@ -159,6 +161,7 @@ def generate_assemblies(
     allow_insertion_assemblies: bool,
     assembly_kwargs: dict | None = None,
     product_callback: Callable[[Dseqrecord], Dseqrecord] = lambda x: x,
+    recombination_mode: bool = False,
 ) -> dict[Literal['sources', 'sequences'], list[AssemblySource] | list[TextFileSequence]]:
     if assembly_kwargs is None:
         assembly_kwargs = {}
@@ -175,10 +178,15 @@ def generate_assemblies(
             circular_assemblies = asm.get_circular_assemblies()
             out_sources += [create_source(a, True) for a in circular_assemblies]
             if not circular_only:
-                out_sources += [
-                    create_source(a, False)
-                    for a in filter_linear_subassemblies(asm.get_linear_assemblies(), circular_assemblies, fragments)
-                ]
+                if not recombination_mode:
+                    out_sources += [
+                        create_source(a, False)
+                        for a in filter_linear_subassemblies(
+                            asm.get_linear_assemblies(), circular_assemblies, fragments
+                        )
+                    ]
+                else:
+                    out_sources += [create_source(a, False) for a in asm.get_insertion_assemblies()]
         else:
             asm = SingleFragmentAssembly(fragments, algorithm=algo, **assembly_kwargs)
             out_sources.extend(create_source(a, True) for a in asm.get_circular_assemblies())
@@ -385,13 +393,16 @@ async def homologous_recombination(
     '/gibson_assembly',
     response_model=create_model(
         'GibsonAssemblyResponse',
-        sources=(list[Union[GibsonAssemblySource, OverlapExtensionPCRLigationSource, InFusionSource]], ...),
+        sources=(
+            list[Union[GibsonAssemblySource, OverlapExtensionPCRLigationSource, InFusionSource, InVivoAssemblySource]],
+            ...,
+        ),
         sequences=(list[TextFileSequence], ...),
     ),
 )
 async def gibson_assembly(
     sequences: conlist(TextFileSequence, min_length=1),
-    source: Union[GibsonAssemblySource, OverlapExtensionPCRLigationSource, InFusionSource],
+    source: Union[GibsonAssemblySource, OverlapExtensionPCRLigationSource, InFusionSource, InVivoAssemblySource],
     minimal_homology: int = Query(
         40, description='The minimum homology between consecutive fragments in the assembly.'
     ),
@@ -522,3 +533,30 @@ async def gateway(
         return {'sources': sources, 'sequences': sequences}
 
     return resp
+
+
+@router.post(
+    '/cre_lox_recombination',
+    response_model=create_model(
+        'CreLoxRecombinationResponse',
+        sources=(list[CreLoxRecombinationSource], ...),
+        sequences=(list[TextFileSequence], ...),
+    ),
+)
+async def cre_lox_recombination(source: CreLoxRecombinationSource, sequences: conlist(TextFileSequence, min_length=1)):
+    fragments = [read_dsrecord_from_json(seq) for seq in sequences]
+
+    # Lambda function for code clarity
+    def create_source(a, is_circular):
+        return CreLoxRecombinationSource.from_assembly(
+            assembly=a, circular=is_circular, id=source.id, fragments=fragments
+        )
+
+    resp = generate_assemblies(
+        source, create_source, fragments, False, cre_loxP_overlap, True, recombination_mode=True
+    )
+
+    if len(resp['sources']) == 0:
+        raise HTTPException(400, 'No compatible Cre/Lox recombination was found.')
+
+    return resp

{opencloning-0.2.7.2 → opencloning-0.2.8}/src/opencloning/gateway.py

@@ -1,31 +1,10 @@
-from Bio.Data.IUPACData import ambiguous_dna_values as _ambiguous_dna_values
 from Bio.Seq import reverse_complement
 from pydna.dseqrecord import Dseqrecord as _Dseqrecord
 import re
 import itertools as _itertools
 from Bio.SeqFeature import SimpleLocation, SeqFeature
 from pydna.utils import shift_location
-
-ambiguous_only_dna_values = {**_ambiguous_dna_values}
-for normal_base in 'ACGT':
-    del ambiguous_only_dna_values[normal_base]
-
-
-def compute_regex_site(site: str) -> str:
-    upper_site = site.upper()
-    for k, v in ambiguous_only_dna_values.items():
-        if len(v) > 1:
-            upper_site = upper_site.replace(k, f"[{''.join(v)}]")
-
-    # Make case insensitive
-    upper_site = f'(?i){upper_site}'
-    return upper_site
-
-
-def dseqrecord_finditer(pattern: str, seq: _Dseqrecord) -> list[re.Match]:
-    query = str(seq.seq) if not seq.circular else str(seq.seq) * 2
-    matches = re.finditer(pattern, query)
-    return (m for m in matches if m.start() <= len(seq))
+from .dna_utils import compute_regex_site, dseqrecord_finditer
 
 
 raw_gateway_common = {

{opencloning-0.2.7.2 → opencloning-0.2.8}/src/opencloning/ncbi_requests.py

@@ -32,9 +32,11 @@ async def get_sequence_accessions_from_assembly_accession(assembly_accession: st
     resp = await async_get(url, headers=headers)
     data = resp.json()
     if 'reports' in data:
-        return [report['refseq_accession'] for report in data['reports']] + [
-            report['genbank_accession'] for report in data['reports']
+        refseq_accessions = [report['refseq_accession'] for report in data['reports'] if 'refseq_accession' in report]
+        genbank_accessions = [
+            report['genbank_accession'] for report in data['reports'] if 'genbank_accession' in report
         ]
+        return refseq_accessions + genbank_accessions
     elif 'total_count' in data:
         raise HTTPException(400, f'No sequence accessions linked, see {url}')
     else:

{opencloning-0.2.7.2 → opencloning-0.2.8}/src/opencloning/pydantic_models.py

@@ -45,6 +45,8 @@ from opencloning_linkml.datamodel import (
     IGEMSource as _IGEMSource,
     ReverseComplementSource as _ReverseComplementSource,
     SEVASource as _SEVASource,
+    CreLoxRecombinationSource as _CreLoxRecombinationSource,
+    InVivoAssemblySource as _InVivoAssemblySource,
 )
 from pydna.utils import shift_location as _shift_location
 from .assembly2 import edge_representation2subfragment_representation, subfragment_representation2edge_representation
@@ -338,6 +340,10 @@ class InFusionSource(AssemblySourceCommonClass, _InFusionSource):
     pass
 
 
+class InVivoAssemblySource(AssemblySourceCommonClass, _InVivoAssemblySource):
+    pass
+
+
 class CRISPRSource(AssemblySourceCommonClass, _CRISPRSource):
 
     # TODO
@@ -384,6 +390,10 @@ class GatewaySource(AssemblySourceCommonClass, _GatewaySource):
         return super().from_assembly(assembly, id, circular, fragments, reaction_type=reaction_type)
 
 
+class CreLoxRecombinationSource(AssemblySourceCommonClass, _CreLoxRecombinationSource):
+    pass
+
+
 class OligoHybridizationSource(SourceCommonClass, _OligoHybridizationSource):
     pass