minerva-dna 0.1.0__tar.gz

minerva_dna-0.1.0/LICENSE

@@ -0,0 +1,202 @@
+
+                                 Apache License
+                           Version 2.0, January 2004
+                        http://www.apache.org/licenses/
+
+   TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION
+
+   1. Definitions.
+
+      "License" shall mean the terms and conditions for use, reproduction,
+      and distribution as defined by Sections 1 through 9 of this document.
+
+      "Licensor" shall mean the copyright owner or entity authorized by
+      the copyright owner that is granting the License.
+
+      "Legal Entity" shall mean the union of the acting entity and all
+      other entities that control, are controlled by, or are under common
+      control with that entity. For the purposes of this definition,
+      "control" means (i) the power, direct or indirect, to cause the
+      direction or management of such entity, whether by contract or
+      otherwise, or (ii) ownership of fifty percent (50%) or more of the
+      outstanding shares, or (iii) beneficial ownership of such entity.
+
+      "You" (or "Your") shall mean an individual or Legal Entity
+      exercising permissions granted by this License.
+
+      "Source" form shall mean the preferred form for making modifications,
+      including but not limited to software source code, documentation
+      source, and configuration files.
+
+      "Object" form shall mean any form resulting from mechanical
+      transformation or translation of a Source form, including but
+      not limited to compiled object code, generated documentation,
+      and conversions to other media types.
+
+      "Work" shall mean the work of authorship, whether in Source or
+      Object form, made available under the License, as indicated by a
+      copyright notice that is included in or attached to the work
+      (an example is provided in the Appendix below).
+
+      "Derivative Works" shall mean any work, whether in Source or Object
+      form, that is based on (or derived from) the Work and for which the
+      editorial revisions, annotations, elaborations, or other modifications
+      represent, as a whole, an original work of authorship. For the purposes
+      of this License, Derivative Works shall not include works that remain
+      separable from, or merely link (or bind by name) to the interfaces of,
+      the Work and Derivative Works thereof.
+
+      "Contribution" shall mean any work of authorship, including
+      the original version of the Work and any modifications or additions
+      to that Work or Derivative Works thereof, that is intentionally
+      submitted to Licensor for inclusion in the Work by the copyright owner
+      or by an individual or Legal Entity authorized to submit on behalf of
+      the copyright owner. For the purposes of this definition, "submitted"
+      means any form of electronic, verbal, or written communication sent
+      to the Licensor or its representatives, including but not limited to
+      communication on electronic mailing lists, source code control systems,
+      and issue tracking systems that are managed by, or on behalf of, the
+      Licensor for the purpose of discussing and improving the Work, but
+      excluding communication that is conspicuously marked or otherwise
+      designated in writing by the copyright owner as "Not a Contribution."
+
+      "Contributor" shall mean Licensor and any individual or Legal Entity
+      on behalf of whom a Contribution has been received by Licensor and
+      subsequently incorporated within the Work.
+
+   2. Grant of Copyright License. Subject to the terms and conditions of
+      this License, each Contributor hereby grants to You a perpetual,
+      worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+      copyright license to reproduce, prepare Derivative Works of,
+      publicly display, publicly perform, sublicense, and distribute the
+      Work and such Derivative Works in Source or Object form.
+
+   3. Grant of Patent License. Subject to the terms and conditions of
+      this License, each Contributor hereby grants to You a perpetual,
+      worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+      (except as stated in this section) patent license to make, have made,
+      use, offer to sell, sell, import, and otherwise transfer the Work,
+      where such license applies only to those patent claims licensable
+      by such Contributor that are necessarily infringed by their
+      Contribution(s) alone or by combination of their Contribution(s)
+      with the Work to which such Contribution(s) was submitted. If You
+      institute patent litigation against any entity (including a
+      cross-claim or counterclaim in a lawsuit) alleging that the Work
+      or a Contribution incorporated within the Work constitutes direct
+      or contributory patent infringement, then any patent licenses
+      granted to You under this License for that Work shall terminate
+      as of the date such litigation is filed.
+
+   4. Redistribution. You may reproduce and distribute copies of the
+      Work or Derivative Works thereof in any medium, with or without
+      modifications, and in Source or Object form, provided that You
+      meet the following conditions:
+
+      (a) You must give any other recipients of the Work or
+          Derivative Works a copy of this License; and
+
+      (b) You must cause any modified files to carry prominent notices
+          stating that You changed the files; and
+
+      (c) You must retain, in the Source form of any Derivative Works
+          that You distribute, all copyright, patent, trademark, and
+          attribution notices from the Source form of the Work,
+          excluding those notices that do not pertain to any part of
+          the Derivative Works; and
+
+      (d) If the Work includes a "NOTICE" text file as part of its
+          distribution, then any Derivative Works that You distribute must
+          include a readable copy of the attribution notices contained
+          within such NOTICE file, excluding those notices that do not
+          pertain to any part of the Derivative Works, in at least one
+          of the following places: within a NOTICE text file distributed
+          as part of the Derivative Works; within the Source form or
+          documentation, if provided along with the Derivative Works; or,
+          within a display generated by the Derivative Works, if and
+          wherever such third-party notices normally appear. The contents
+          of the NOTICE file are for informational purposes only and
+          do not modify the License. You may add Your own attribution
+          notices within Derivative Works that You distribute, alongside
+          or as an addendum to the NOTICE text from the Work, provided
+          that such additional attribution notices cannot be construed
+          as modifying the License.
+
+      You may add Your own copyright statement to Your modifications and
+      may provide additional or different license terms and conditions
+      for use, reproduction, or distribution of Your modifications, or
+      for any such Derivative Works as a whole, provided Your use,
+      reproduction, and distribution of the Work otherwise complies with
+      the conditions stated in this License.
+
+   5. Submission of Contributions. Unless You explicitly state otherwise,
+      any Contribution intentionally submitted for inclusion in the Work
+      by You to the Licensor shall be under the terms and conditions of
+      this License, without any additional terms or conditions.
+      Notwithstanding the above, nothing herein shall supersede or modify
+      the terms of any separate license agreement you may have executed
+      with Licensor regarding such Contributions.
+
+   6. Trademarks. This License does not grant permission to use the trade
+      names, trademarks, service marks, or product names of the Licensor,
+      except as required for reasonable and customary use in describing the
+      origin of the Work and reproducing the content of the NOTICE file.
+
+   7. Disclaimer of Warranty. Unless required by applicable law or
+      agreed to in writing, Licensor provides the Work (and each
+      Contributor provides its Contributions) on an "AS IS" BASIS,
+      WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or
+      implied, including, without limitation, any warranties or conditions
+      of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A
+      PARTICULAR PURPOSE. You are solely responsible for determining the
+      appropriateness of using or redistributing the Work and assume any
+      risks associated with Your exercise of permissions under this License.
+
+   8. Limitation of Liability. In no event and under no legal theory,
+      whether in tort (including negligence), contract, or otherwise,
+      unless required by applicable law (such as deliberate and grossly
+      negligent acts) or agreed to in writing, shall any Contributor be
+      liable to You for damages, including any direct, indirect, special,
+      incidental, or consequential damages of any character arising as a
+      result of this License or out of the use or inability to use the
+      Work (including but not limited to damages for loss of goodwill,
+      work stoppage, computer failure or malfunction, or any and all
+      other commercial damages or losses), even if such Contributor
+      has been advised of the possibility of such damages.
+
+   9. Accepting Warranty or Additional Liability. While redistributing
+      the Work or Derivative Works thereof, You may choose to offer,
+      and charge a fee for, acceptance of support, warranty, indemnity,
+      or other liability obligations and/or rights consistent with this
+      License. However, in accepting such obligations, You may act only
+      on Your own behalf and on Your sole responsibility, not on behalf
+      of any other Contributor, and only if You agree to indemnify,
+      defend, and hold each Contributor harmless for any liability
+      incurred by, or claims asserted against, such Contributor by reason
+      of your accepting any such warranty or additional liability.
+
+   END OF TERMS AND CONDITIONS
+
+   APPENDIX: How to apply the Apache License to your work.
+
+      To apply the Apache License to your work, attach the following
+      boilerplate notice, with the fields enclosed by brackets "[]"
+      replaced with your own identifying information. (Don't include
+      the brackets!)  The text should be enclosed in the appropriate
+      comment syntax for the file format. We also recommend that a
+      file or class name and description of purpose be included on the
+      same "printed page" as the copyright notice for easier
+      identification within third-party archives.
+
+   Copyright 2026 Garyk Brixi
+
+   Licensed under the Apache License, Version 2.0 (the "License");
+   you may not use this file except in compliance with the License.
+   You may obtain a copy of the License at
+
+       http://www.apache.org/licenses/LICENSE-2.0
+
+   Unless required by applicable law or agreed to in writing, software
+   distributed under the License is distributed on an "AS IS" BASIS,
+   WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+   See the License for the specific language governing permissions and
+   limitations under the License.

minerva_dna-0.1.0/PKG-INFO

@@ -0,0 +1,355 @@
+Metadata-Version: 2.4
+Name: minerva-dna
+Version: 0.1.0
+Summary: Minerva: genomic language models for coevolutionary mining
+Author: Gary Brixi
+License-Expression: Apache-2.0
+Project-URL: Homepage, https://github.com/garykbrixi/minerva
+Project-URL: Source, https://github.com/garykbrixi/minerva
+Project-URL: Model, https://huggingface.co/gbrixi/minerva-mlm
+Requires-Python: >=3.11
+Description-Content-Type: text/markdown
+License-File: LICENSE
+Requires-Dist: torch<3,>=2.1.0
+Requires-Dist: transformers<6,>=4.41.0
+Requires-Dist: numpy<3,>=1.23
+Requires-Dist: biopython<2,>=1.80
+Requires-Dist: pyrodigal<4,>=3.0
+Requires-Dist: huggingface_hub<2,>=0.23.0
+Requires-Dist: safetensors<1,>=0.4.0
+Requires-Dist: matplotlib<4,>=3.7
+Requires-Dist: ViennaRNA<3,>=2.6
+Requires-Dist: plotly<7,>=5.0
+Requires-Dist: datasets<5,>=2.16
+Requires-Dist: accelerate<2,>=0.26
+Requires-Dist: peft<1,>=0.10.0
+Provides-Extra: flash
+Requires-Dist: flash-attn>=2.5.8; extra == "flash"
+Provides-Extra: viz
+Requires-Dist: bokeh<4,>=3; extra == "viz"
+Provides-Extra: dev
+Requires-Dist: pytest<10,>=7; extra == "dev"
+Requires-Dist: nbclient<1,>=0.8; extra == "dev"
+Requires-Dist: ipykernel<8,>=6; extra == "dev"
+Requires-Dist: ipywidgets<9,>=8; extra == "dev"
+Dynamic: license-file
+
+
+<h1><img src="https://raw.githubusercontent.com/garykbrixi/minerva/main/assets/minerva_owl.png" alt="" height="46" valign="middle"> Minerva</h1>
+
+[![tests](https://github.com/garykbrixi/minerva/actions/workflows/tests.yml/badge.svg)](https://github.com/garykbrixi/minerva/actions/workflows/tests.yml)
+[![python](https://img.shields.io/badge/python-3.11%2B-blue)](https://github.com/garykbrixi/minerva)
+[![model](https://img.shields.io/badge/%F0%9F%A4%97%20Hugging%20Face-Minerva--MLM-yellow)](https://huggingface.co/gbrixi/minerva-mlm)
+[![license](https://img.shields.io/badge/license-Apache--2.0-green)](https://github.com/garykbrixi/minerva/blob/main/LICENSE)
+
+**Coevolutionary discovery using genome language models**
+
+Minerva predicts coevolution using genome language models. Powered by Minerva-MLM, it delivers database-scale, alignment-free, interaction-specific predictions across prokaryotic genomes. Through adaptation on homologous loci, Minerva can discover additional interactions.
+
+[Install](#install) · [Checkpoints](#pretrained-checkpoints) · [Quick start](#quick-start) · [Preparing inputs](#preparing-inputs) · [Interaction heads](#interaction-heads) · [Jacobian fingerprinting](#jacobian-fingerprinting) · [RNA structure](#rna-secondary-structure) · [Eukaryotic RNA](#eukaryotic-rna) · [Finetuning](#finetuning) · [Examples](https://github.com/garykbrixi/minerva/tree/main/examples/) · [Citation](#citation)
+
+## Install
+
+To install Minerva, use:
+
+```bash
+pip install minerva-dna
+```
+
+Minerva uses `flash-attn` automatically when it is installed. Otherwise it falls
+back to PyTorch SDPA. Please install flash attention first for faster inference.
+
+## Pretrained Checkpoints
+
+Minerva-MLM is a 650M parameter transformer trained for over 1.3 trillion tokens (~3.4 Terabases). Minerva-MLM is initialized from [gLM2 650M](https://github.com/TattaBio/gLM2) and adopts the mixed-modality tokenization, and was trained at 4096 and 8192 context lengths.
+
+Checkpoints are hosted on Hugging Face:
+
+| Model       | Context | Hugging Face repo                                   |
+| ----------- | ------- | --------------------------------------------------- |
+| Minerva-MLM   | 4096    | [`gbrixi/minerva-mlm`](https://huggingface.co/gbrixi/minerva-mlm)         |
+| Minerva-MLM-8k   | 8192    | [`gbrixi/minerva-mlm-8k`](https://huggingface.co/gbrixi/minerva-mlm-8k)   |
+
+Minerva-MLM checkpoints include three interaction heads and Jacobian fingerprint types:
+
+- **base_pairing** — RNA base-pairing contacts
+- **protein** — protein contact prediction
+- **repeat** — repeat element detection
+
+## Quick start
+
+```python
+from transformers import AutoTokenizer
+from minerva import MinervaForMaskedLM
+import torch
+
+model = MinervaForMaskedLM.from_pretrained(
+    "gbrixi/minerva-mlm", torch_dtype=torch.bfloat16,
+).cuda().eval()
+tokenizer = AutoTokenizer.from_pretrained("gbrixi/minerva-mlm")
+
+tokens = tokenizer(
+    "<+>cgcggggtggagcagcctggtagctcgtcgggctcataacccgaagatcgtcggttcaaatccggcccccgcaacca",
+    return_tensors="pt",
+).to(model.device)
+
+with torch.no_grad():
+    outputs = model(**tokens, output_interactions=True)
+
+base_pairing = outputs.interactions["base_pairing"]  # [batch, L, L]
+protein = outputs.interactions["protein"]            # [batch, L, L]
+repeat = outputs.interactions["repeat"]              # [batch, L, L]
+```
+
+> Importing the class directly needs no `trust_remote_code`. Without the package
+> installed, use `AutoModelForMaskedLM.from_pretrained(repo, trust_remote_code=True)`.
+
+## Preparing inputs
+
+Minerva reads a **mixed protein + DNA** sequence: coding regions are upper-case
+amino acids, intergenic regions are lower-case nucleotides, and `<+>` / `<->`
+markers denote strand.
+
+```
+<+>MALTKVEKRNRIKRRVRGK<+>aatttaaggaa<->MLGIDNIERVKPGGLELVDRLV
+   └── CDS (protein) ──┘└ intergenic ┘└──── CDS on - strand ────┘
+```
+
+There are **three ways** to produce this format depending on what you start
+with:
+
+| You have | Use | What happens |
+| --- | --- | --- |
+| **Annotated GenBank** (CDS features) | `minerva.data.extract_and_tokenize_gb(path)` | CDS translated, intergenic kept as DNA, strand markers inserted. One sequence per LOCUS. |
+| **Unannotated sequence** (FASTA / raw DNA) | `minerva.gene_calling.build_minerva_input(seq)` | Genes called with **Pyrodigal**, then packaged. |
+| **Raw genome + external CDS calls** | `minerva.sequence_utils.build_prodigal_mixed_sequence(seq, cds)` | Your own `[{start, end, strand}]` calls packaged, with genome↔token maps. |
+
+### From unannotated sequence (gene calling)
+
+If you only have a FASTA file or a raw nucleotide string, we use [Pyrodigal](https://github.com/althonos/pyrodigal) to automatically call genes:
+
+```python
+from minerva.gene_calling import build_minerva_input, fasta_to_minerva_inputs
+
+# From a single nucleotide string
+out = build_minerva_input(sequence)          # dict: token_string + coord maps
+token_string = out["token_string"]
+
+# From a FASTA file (one result per record)
+inputs = fasta_to_minerva_inputs("contigs.fasta")
+```
+
+Pyrodigal needs ≥ 20 kb to estimate gene-scoring statistics from a sequence;
+shorter contigs use its pre-trained profiles, which `meta=True` forces
+for metagenomic assemblies. A CDS token is one amino acid and an intergenic
+token one base, so `token_to_genome` / `genome_to_token` map token index to
+genome position.
+
+### Context length & capping
+
+Minerva's context is 4096 (`gbrixi/minerva-mlm`) or 8192 tokens
+(`gbrixi/minerva-mlm-8k`). One token is one amino acid, one nucleotide, or one
+strand marker, so a typical (~88 % coding) bacterial genome packs to ~10 kb per
+4096 tokens (~20 kb for the 8k model).
+
+Pass `max_tokens` to the builders to cap a sequence. It truncates at a gene
+boundary, keeps the 5′ end, and keeps the coordinate maps consistent.
+
+```python
+out = build_minerva_input(sequence, max_tokens=4096)   # <= 4096 tokens
+```
+
+To cover a whole genome, tile it instead with
+`minerva.sequence_utils.chunk_sequence_with_stride`.
+
+### Translation tables
+
+CDS translate with NCBI table 11 by default, but a GenBank feature's own
+`/transl_table` takes precedence. Override with `translation_table=` on the
+builders or `--translation_table` on `scripts/finetune.py`.
+
+See [`examples/`](https://github.com/garykbrixi/minerva/tree/main/examples/) for runnable, end-to-end walkthroughs.
+
+## Using the model
+
+These continue from the [quick start](#quick-start), with `model`, `tokenizer`, `tokens` and
+`outputs` already defined.
+
+### Interaction heads
+
+To plot the interaction-head outputs:
+
+```python
+from minerva.visualization import plot_interactions
+
+token_list = tokenizer.convert_ids_to_tokens(tokens["input_ids"][0].tolist())
+plot_interactions(outputs.interactions, tokens=token_list)
+```
+
+Set `interaction_layers=6` to use the six-layer interaction heads:
+
+```python
+outputs = model(**tokens, output_interactions=True, interaction_layers=6)
+```
+
+Raw attention tensors follow the Hugging Face convention:
+
+```python
+outputs = model(
+    **tokens,
+    output_interactions=True,
+    output_attentions=True,
+    attention_layers=[31, 32],
+)
+```
+
+### Jacobian fingerprinting
+
+Use `get_fingerprints` when you want named interaction-pattern channels from a
+sequence. It computes the required full categorical Jacobian internally and returns
+a `FingerprintResult`; the large raw Jacobian is not kept unless requested.
+
+```python
+sequence = "<+>cgcggggtggagcagcctggtagctcgtcgggctcataacccgaagatcgtcggttcaaatccggcccccgcaacca"
+window = (0, min(len(sequence), 96))
+
+fp = model.get_fingerprints(
+    sequence,
+    tokenizer,
+    position_range=window,
+    max_batch_size=64,
+)
+
+fp.channel_names                     # ["basepairing", "repeat", "protein", "other"]
+basepairing = fp["basepairing"]      # [L, L]
+protein = fp["protein"]              # [L, L]
+repeat = fp["repeat"]                # [L, L]
+```
+
+To plot the result:
+
+```python
+from minerva.visualization import plot_fingerprints
+
+plot_fingerprints(fp, title="Minerva multimodal fingerprint")
+```
+
+### RNA secondary structure
+
+The `base_pairing` head returns a dense contact map which can be converted to an RNA structure using `minerva.rna_structure`:
+
+```python
+from minerva.rna_structure import call_structure, call_structures
+
+token_list = tokenizer.convert_ids_to_tokens(tokens["input_ids"][0].tolist())
+s = call_structure(outputs.interactions["base_pairing"], tokens=token_list)
+
+s.dot_bracket        # '(((((((..((((........)))).(((((.......)))))...'
+s.to_vienna("t.fa")  # read by RNAfold, forna, VARNA, R2R
+s.to_ct("t.ct")      # connect table, keeps pseudoknots
+s.plot()             # matplotlib Figure
+```
+
+Each intergenic region of a mixed locus is a separate molecule, so
+`call_structures` returns one structure per region:
+
+```python
+structures = call_structures(outputs.interactions["base_pairing"], token_list)
+```
+
+An interactive viewer is in
+[`examples/notebooks/rna_structure.ipynb`](https://github.com/garykbrixi/minerva/blob/main/examples/notebooks/rna_structure.ipynb).
+
+## Eukaryotic RNA
+
+For researchers studying eukaryotic RNAs, Minerva provides a RiNALMo-based checkpoint with base-pairing and repeat interaction heads. See [eukaryotic RNA support](https://github.com/garykbrixi/minerva/tree/main/examples/eukaryotic_rna/) for usage and finetuning.
+
+## Finetuning
+
+`scripts/finetune.py` wraps HF `Trainer` + `accelerate` with Minerva's MLM loss.
+It supports full finetuning and LoRA, and ingests GenBank files directly.
+
+```bash
+# LoRA finetune
+accelerate launch --num_processes=8 scripts/finetune.py \
+    --output_dir ./output \
+    --genbank_file genome.gb \
+    --tokenizer_name gbrixi/minerva-mlm \
+    --model_name_or_path gbrixi/minerva-mlm \
+    --use_lora --lora_r 1 --lora_alpha 2 \
+    --learning_rate 1e-4 --bf16
+
+# Full finetune on a GenBank file across 8 GPUs
+accelerate launch --num_processes=8 scripts/finetune.py \
+    --output_dir ./output \
+    --genbank_file genome.gb \
+    --tokenizer_name gbrixi/minerva-mlm \
+    --model_name_or_path gbrixi/minerva-mlm \
+    --per_device_train_batch_size 4 \
+    --bf16
+```
+
+Minerva-MLM LoRA checkpoints loaded with PEFT:
+
+```python
+from peft import PeftModel
+from minerva import MinervaForMaskedLM
+
+base = MinervaForMaskedLM.from_pretrained("gbrixi/minerva-mlm")
+model = PeftModel.from_pretrained(base, "path/to/lora_ckpt")
+```
+
+A LOCUS longer than `--max_seq_length` is split into non-overlapping blocks,
+each its own training example, see
+`minerva.finetuning.load_genbank_dataset`.
+
+## Repo layout
+
+```
+minerva/
+  modeling_minerva.py   # MinervaConfig / MinervaForMaskedLM (custom transformer + heads)
+  modeling_rinalmo.py   # RiNALMoMinervaForMaskedLM (RNA backbone + heads)
+  tokenization_rinalmo.py # RiNALMo nucleotide tokenizer
+  backbones.py          # Backbone-specific training configuration
+  interaction_heads.py # Shared interaction heads
+  data.py               # GenBank parsing + tokenization
+  gene_calling.py       # Pyrodigal gene calling: FASTA/raw DNA -> mixed tokens
+  sequence_utils.py     # reverse-complement + external-CDS -> mixed tokens
+  masking.py            # DataCollatorForMinervaMLM
+  losses.py             # grouped_mlm_loss
+  example_data/         # sample GenBank loci (minerva.data.example_path)
+scripts/
+  finetune.py                  # HF Trainer / accelerate wrapper
+examples/                       # end-to-end tutorials & notebooks
+  call_genes_from_fasta.py      # FASTA/raw DNA -> Minerva input walkthrough
+  notebooks/                    # interactive Colab-ready notebooks
+tests/                          # package unit + smoke tests
+```
+
+## Citation
+
+If you use Minerva in your work, please cite the paper.
+
+If you use the Jacobian fingerprints, please also cite the categorical Jacobian:
+
+> Zhang, Z., Wayment-Steele, H.K., Brixi, G., Wang, H., Kern, D. & Ovchinnikov, S. Protein language
+> models learn evolutionary statistics of interacting sequence motifs. *Proc. Natl. Acad. Sci. U.S.A.*
+> **121** (45), e2406285121 (2024). https://doi.org/10.1073/pnas.2406285121
+
+```bibtex
+@article{zhang2024categoricaljacobian,
+  title   = {Protein language models learn evolutionary statistics of interacting sequence motifs},
+  author  = {Zhang, Z. and Wayment-Steele, H. K. and Brixi, G. and Wang, H. and Kern, D. and Ovchinnikov, S.},
+  journal = {Proceedings of the National Academy of Sciences},
+  volume  = {121},
+  number  = {45},
+  pages   = {e2406285121},
+  year    = {2024},
+  doi     = {10.1073/pnas.2406285121}
+}
+```
+
+## License
+
+Apache 2.0 — see [LICENSE](https://github.com/garykbrixi/minerva/blob/main/LICENSE). Minerva-MLM is initialized from
+[gLM2 650M](https://github.com/TattaBio/gLM2) (Tatta Bio, Apache 2.0).