levseq 1.0.2__tar.gz → 1.1.0__tar.gz

{levseq-1.0.2/levseq.egg-info → levseq-1.1.0}/PKG-INFO

@@ -1,8 +1,8 @@
 Metadata-Version: 2.1
 Name: levseq
-Version: 1.0.2
+Version: 1.1.0
 Home-page: https://github.com/fhalab/levseq/
-Author: Yueming Long, Emreay Gursoy, Ariane Mora
+Author: Yueming Long, Emreay Gursoy, Ariane Mora, Francesca-Zhoufan Li
 Author-email: ylong@caltech.edu
 License: GPL3
 Project-URL: Bug Tracker, https://github.com/fhalab/levseq/
@@ -90,7 +90,7 @@ git clone https://github.com/fhalab/LevSeq.git
 ```
 
 ```
-conda create --name levseq python=3.8 -y
+conda create --name levseq python=3.10 -y
 ```
 
 ```
@@ -133,7 +133,7 @@ conda install conda-forge::gcc=13
 LevSeq can be run using the command line interface. Here's the basic structure of the command:
 
 ```
-levseq <name> <location to data folder> <location of reference csv file>
+levseq <name of the run you can make this whatever> <location to data folder> <location of reference csv file>
 ```
 #### Required Arguments
 1. Name of the experiment, this will be the name of the output folder
@@ -154,7 +154,8 @@ For installing the whole pipeline, you'll need to use the docker image. For this
 operating system (https://docs.docker.com/engine/install/).
 
 
-To build the docker image run (within the main folder that contains the `Dockerfile`):
+To build the docker image run (within the main folder that contains the `Dockerfile`). Note building does **not** work 
+on Mac M3 chip, please use a ubuntu machine to build the docker image!
 
 ```
 docker build -t levseq .
@@ -170,6 +171,7 @@ Note! The docker image should work with linux, and mac, however, different mac a
 Basically the -v connects a folder on your computer with the output from the minION sequencer with the docker image that will take these results and then perform 
 demultiplexing and variant calling.
 
+docker run -v /disk1/ariane/vscode/LevSeq/manuscript/Data/20241116-YL-LevSeq-parlqep400-1-2-P25-28:/levseq_results/ levseq docker-test levseq_results/ levseq_results/LevSeq-T1.csv
 ```
  docker run -v /Users/XXXX/Documents/LevSeq/data:/levseq_results/ levseq 20240502 levseq_results/20240502/ levseq_results/20240502-YL-ParLQ-ep2.csv
 ```

{levseq-1.0.2 → levseq-1.1.0}/README.md

@@ -44,7 +44,7 @@ git clone https://github.com/fhalab/LevSeq.git
 ```
 
 ```
-conda create --name levseq python=3.8 -y
+conda create --name levseq python=3.10 -y
 ```
 
 ```
@@ -87,7 +87,7 @@ conda install conda-forge::gcc=13
 LevSeq can be run using the command line interface. Here's the basic structure of the command:
 
 ```
-levseq <name> <location to data folder> <location of reference csv file>
+levseq <name of the run you can make this whatever> <location to data folder> <location of reference csv file>
 ```
 #### Required Arguments
 1. Name of the experiment, this will be the name of the output folder
@@ -108,7 +108,8 @@ For installing the whole pipeline, you'll need to use the docker image. For this
 operating system (https://docs.docker.com/engine/install/).
 
 
-To build the docker image run (within the main folder that contains the `Dockerfile`):
+To build the docker image run (within the main folder that contains the `Dockerfile`). Note building does **not** work 
+on Mac M3 chip, please use a ubuntu machine to build the docker image!
 
 ```
 docker build -t levseq .
@@ -124,6 +125,7 @@ Note! The docker image should work with linux, and mac, however, different mac a
 Basically the -v connects a folder on your computer with the output from the minION sequencer with the docker image that will take these results and then perform 
 demultiplexing and variant calling.
 
+docker run -v /disk1/ariane/vscode/LevSeq/manuscript/Data/20241116-YL-LevSeq-parlqep400-1-2-P25-28:/levseq_results/ levseq docker-test levseq_results/ levseq_results/LevSeq-T1.csv
 ```
  docker run -v /Users/XXXX/Documents/LevSeq/data:/levseq_results/ levseq 20240502 levseq_results/20240502/ levseq_results/20240502-YL-ParLQ-ep2.csv
 ```

{levseq-1.0.2 → levseq-1.1.0}/levseq/__init__.py

@@ -18,8 +18,8 @@
 __title__ = 'levseq'
 __description__ = 'LevSeq nanopore sequencing'
 __url__ = 'https://github.com/fhalab/levseq/'
-__version__ = '1.0.2'
-__author__ = 'Yueming Long, Emreay Gursoy, Ariane Mora'
+__version__ = '1.1.0'
+__author__ = 'Yueming Long, Emreay Gursoy, Ariane Mora, Francesca-Zhoufan Li'
 __author_email__ = 'ylong@caltech.edu'
 __license__ = 'GPL3'
 

{levseq-1.0.2 → levseq-1.1.0}/levseq/barcoding/minion_barcodes.fasta

@@ -190,7 +190,6 @@ GATTGTCCTCAAACTGCCACCTAC
 CCTGTCTGGAAGAAGAATGGACTT
 >NB96
 CTGAACGGTCATAGAGTCCACCAT
-
 >RB01
 AAGAAAGTTGTCGGTGTCTTTGTG
 >RB02
@@ -242,7 +241,7 @@ GCATAGTTCTGCATGATGGGTTAG
 >RB25
 GTAAGTTGGGTATGCAACGCAATG
 >RB26
-ACTATGCCTTTCCGTGAAACAGTT
+CATACAGCGACTACGCATTCTCAT
 >RB27
 CGACGGTTAGATTCACCTCTTACA
 >RB28
@@ -382,5 +381,4 @@ GATTGTCCTCAAACTGCCACCTAC
 >RB95
 CCTGTCTGGAAGAAGAATGGACTT
 >RB96
-CTGAACGGTCATAGAGTCCACCAT
-
+CTGAACGGTCATAGAGTCCACCAT