edentity 1.4.3__tar.gz

edentity-1.4.3/.gitignore

@@ -0,0 +1,29 @@
+
+#ignore snakemake logs
+workflow/.snakemake/
+.snakemake/
+
+#ignore reports
+workflow/reports/
+
+#ignore logs
+workflow/logs
+
+#ignore notebooks for now
+workflow/notebooks
+workflow/scripts/samples.ipynb
+
+#test data output
+tests/test
+tests/vsearch
+
+# ignore apptainer
+.cache/
+.conda/
+.condarc
+.DS_Store
+!tests/data/
+
+# ignore galaxy tests
+GalaxyTest/
+__pycache__/

edentity-1.4.3/.gitlab-ci.yml

@@ -0,0 +1,137 @@
+
+variables:  
+  DOCKER_IMAGE: "$CI_REGISTRY_IMAGE:v0.1.0"
+  ARTIFACT_PATH: "./tests/" #  path to where snakemake outputs are expected
+  SNAKEMAKE_ENV: "conda-envs/snakemake/" # would not recommend changing this
+  SNAKEMAKE_VERSION: "8.16.0"
+  GALAXY_ROOT: "tempGalaxy/" # path to where temp galaxy will be installed; change this to absolute path to galaxy root
+
+
+
+# two images will always be pubslished: one with actual version tag and another with same digest but tagged latest :)
+default:
+  # image: $DOCKER_IMAGE  
+  tags:
+    - eDentity-runner # tag the runner to be used for this pipeline
+
+# list pipeline stages
+stages:
+  - prepare
+  - build
+  - linting
+  - test
+  - publish
+  
+# Default rule for all jobs
+.common_rule: &common_rule
+  rules:
+    - if: '$CI_PIPELINE_SOURCE == "merge_request_event"'
+      when: always
+    - if: '$CI_COMMIT_BRANCH == "main"'
+      when: always
+    - if: $CI_COMMIT_TAG
+      when: always
+
+#create snakemake conda env and preserve the environment for the next stages
+install-dependencies:
+  stage: prepare
+  <<: *common_rule
+  script:
+  
+  # create the prefix path in case conda decides not to create
+    - mkdir -p $CI_PROJECT_DIR/$SNAKEMAKE_ENV 
+    - mkdir -p $CI_PROJECT_DIR/conda-envs/unit-tests/
+    - mkdir -p $CI_PROJECT_DIR/conda-envs/pypi-build-and-publish/
+
+  # create conda envs for running snakemake and unittests
+    - conda env create -f environment.yaml --prefix $CI_PROJECT_DIR/$SNAKEMAKE_ENV 
+    - conda create --prefix $CI_PROJECT_DIR/conda-envs/unit-tests/ -c conda-forge flake8 pytest pandas -y
+
+  # create conda env for building and publishing pypackage
+    - conda create --prefix $CI_PROJECT_DIR/conda-envs/pypi-build-and-publish/ -c conda-forge python=3.10 pip twine setuptools setuptools_scm[toml] build wheel -y
+  
+  # preserve the envs created so that next stages can call up
+  artifacts:    
+    paths:
+      - ./conda-envs
+    expire_in: 1 week
+
+
+# # Linting (ignoring "line too long (E127)"" and "continuation line over-indented for visual indent (E501)")
+# # couldnt quite fix these 2 linting errors so ignore them for now
+# linting:
+#   stage: linting
+#   <<: *common_rule  
+#   script: 
+#     - conda run -p $CI_PROJECT_DIR/conda-envs/unit-tests/ flake8  --ignore=E127,E501,E999 edentity/workflow/scripts/
+
+
+build-pypackage:
+  stage: build
+  script:
+    - echo "Building Python package..."
+    - eval "$(conda shell.bash hook)" 
+    - conda activate $CI_PROJECT_DIR/conda-envs/pypi-build-and-publish
+    - python -m build
+  rules:
+    - if: $CI_COMMIT_TAG
+  artifacts:
+    paths:
+      - dist/
+    expire_in: 1 week
+  needs:
+    - install-dependencies
+
+test-edentity-package:
+  stage: test
+  <<: *common_rule  
+  script:
+    - eval "$(conda shell.bash hook)"
+    - conda activate edentity-test-environment # use the build env; install other requirements of edentity package in the conda env
+    - pip install  -e . # install the package in editable mode
+    - edentity  --raw_data_dir tests/data --forward_primer AAACTCGTGCCAGCCACC   --reverse_primer GGGTATCTAATCCCAGTTTG   --work_dir tests/vsearch 
+  artifacts:    
+    paths:
+      - $ARTIFACT_PATH
+    expire_in: 1 week
+  needs:
+    - build-pypackage
+
+publish:
+  stage: publish
+  script:
+    - echo "Publishing package to PyPI..."
+    - eval "$(conda shell.bash hook)"
+    - conda activate $CI_PROJECT_DIR/conda-envs/pypi-build-and-publish
+    - TWINE_PASSWORD=${PYPI_API_TOKEN} TWINE_USERNAME=__token__ python -m twine upload --skip-existing dist/*
+  rules:
+    - if: $CI_COMMIT_TAG
+  needs:
+    - build-pypackage
+    - install-dependencies
+
+
+
+
+
+# test galaxy pipeline THIS part is now done on nbitk galaxy client.
+# this will run the galaxy pipeline and uses diff command to compare 
+# the output with the expected output
+# Ensure the expected output is in the test-data folder
+# and that it was generated with the same params as defined in the test section of tool gaxalaxy xml
+# test-galaxy:
+#   stage: test-galaxy
+#   <<: *common_rule
+#   script:
+#     - eval "$(conda shell.bash hook)"
+#     - conda activate galaxyTest    
+#     - planemo test  --test_data=test-data  edentity-galaxy-pipeline.xml
+#   artifacts:
+#     paths:
+#       - tool_test_output.html
+#       - tool_test_output.json
+#     expire_in: 1 week
+#TO ADD:
+# 1. unit test the ESV table output content. Ideally compare the number of ESVs, the number of samples (columns), the names of the samples
+# Could write a python script that has a predified ESV table and compare it to the output of the pipeline
+# 

edentity-1.4.3/.pre-commit-config.yaml

@@ -0,0 +1,8 @@
+# Requirements for running these pre-commit hooks
+# pre-commit: pip install pre-commit
+
+repos:
+  - repo: https://github.com/gitleaks/gitleaks
+    rev: v8.18.0
+    hooks:
+      - id: gitleaks

edentity-1.4.3/Dockerfile

@@ -0,0 +1,77 @@
+FROM condaforge/mambaforge:24.9.2-0
+LABEL io.github.snakemake.containerized="true"
+LABEL io.github.snakemake.conda_env_hash="428af8958ac834f4d5e69a3faf690bf39fa900031c1f165ab52b89a72457ebf4"
+
+# Step 2: Retrieve conda environments
+
+# Conda environment:
+#   source: workflow/envs/cutadapt.yaml
+#   prefix: /conda-envs/edf345db7c901e7d3dc3ca55e5af56e2
+#   priority: strict
+#   name: cutadapt
+#   channels:
+#     - conda-forge
+#     - bioconda
+#     - nodefaults
+#   dependencies:
+#     - pip
+#     - cutadapt=4.9
+#     - biopython=1.84
+#     - pip:
+#       - nbitk==0.3.2
+RUN mkdir -p /conda-envs/edf345db7c901e7d3dc3ca55e5af56e2
+COPY workflow/envs/cutadapt.yaml /conda-envs/edf345db7c901e7d3dc3ca55e5af56e2/environment.yaml
+
+# Conda environment:
+#   source: workflow/envs/fastp.yaml
+#   prefix: /conda-envs/b588f57bfee906402cd48ab9480dae74
+#   priority: strict
+#   name: fastp
+#   channels:
+#     - conda-forge
+#     - bioconda
+#     - nodefaults
+#   dependencies:  
+#     - fastp=0.24.0
+RUN mkdir -p /conda-envs/b588f57bfee906402cd48ab9480dae74
+COPY workflow/envs/fastp.yaml /conda-envs/b588f57bfee906402cd48ab9480dae74/environment.yaml
+
+# Conda environment:
+#   source: workflow/envs/multiqc.yaml
+#   prefix: /conda-envs/54be30cf1928dd479025b6fec1bd55c4
+#   priority: strict
+#   name: multiqc
+#   channels:
+#     - conda-forge
+#     - bioconda
+#     - nodefaults
+#   dependencies:  
+#     - multiqc=1.27.1
+RUN mkdir -p /conda-envs/54be30cf1928dd479025b6fec1bd55c4
+COPY workflow/envs/multiqc.yaml /conda-envs/54be30cf1928dd479025b6fec1bd55c4/environment.yaml
+
+# Conda environment:
+#   source: workflow/envs/vsearch.yaml
+#   prefix: /conda-envs/1575a372c32dbdce868ad7f639c291bf
+#   priority: strict
+#   name: vsearch
+#   channels:
+#     - conda-forge
+#     - bioconda
+#     - nodefaults
+#   dependencies:
+#     - vsearch=2.28.1
+#     - pip
+#     - biopython=1.84  
+#     - pip:
+#       - nbitk==0.3.2
+RUN mkdir -p /conda-envs/1575a372c32dbdce868ad7f639c291bf
+COPY workflow/envs/vsearch.yaml /conda-envs/1575a372c32dbdce868ad7f639c291bf/environment.yaml
+
+# Step 3: Generate conda environments
+
+RUN conda env create --prefix /conda-envs/edf345db7c901e7d3dc3ca55e5af56e2 --file /conda-envs/edf345db7c901e7d3dc3ca55e5af56e2/environment.yaml && \
+    conda env create --prefix /conda-envs/b588f57bfee906402cd48ab9480dae74 --file /conda-envs/b588f57bfee906402cd48ab9480dae74/environment.yaml && \
+    conda env create --prefix /conda-envs/54be30cf1928dd479025b6fec1bd55c4 --file /conda-envs/54be30cf1928dd479025b6fec1bd55c4/environment.yaml && \
+    conda env create --prefix /conda-envs/1575a372c32dbdce868ad7f639c291bf --file /conda-envs/1575a372c32dbdce868ad7f639c291bf/environment.yaml && \
+    conda clean --all -y

edentity-1.4.3/LICENSE.md

@@ -0,0 +1,201 @@
+                                 Apache License
+                           Version 2.0, January 2004
+                        http://www.apache.org/licenses/
+
+   TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION
+
+   1. Definitions.
+
+      "License" shall mean the terms and conditions for use, reproduction,
+      and distribution as defined by Sections 1 through 9 of this document.
+
+      "Licensor" shall mean the copyright owner or entity authorized by
+      the copyright owner that is granting the License.
+
+      "Legal Entity" shall mean the union of the acting entity and all
+      other entities that control, are controlled by, or are under common
+      control with that entity. For the purposes of this definition,
+      "control" means (i) the power, direct or indirect, to cause the
+      direction or management of such entity, whether by contract or
+      otherwise, or (ii) ownership of fifty percent (50%) or more of the
+      outstanding shares, or (iii) beneficial ownership of such entity.
+
+      "You" (or "Your") shall mean an individual or Legal Entity
+      exercising permissions granted by this License.
+
+      "Source" form shall mean the preferred form for making modifications,
+      including but not limited to software source code, documentation
+      source, and configuration files.
+
+      "Object" form shall mean any form resulting from mechanical
+      transformation or translation of a Source form, including but
+      not limited to compiled object code, generated documentation,
+      and conversions to other media types.
+
+      "Work" shall mean the work of authorship, whether in Source or
+      Object form, made available under the License, as indicated by a
+      copyright notice that is included in or attached to the work
+      (an example is provided in the Appendix below).
+
+      "Derivative Works" shall mean any work, whether in Source or Object
+      form, that is based on (or derived from) the Work and for which the
+      editorial revisions, annotations, elaborations, or other modifications
+      represent, as a whole, an original work of authorship. For the purposes
+      of this License, Derivative Works shall not include works that remain
+      separable from, or merely link (or bind by name) to the interfaces of,
+      the Work and Derivative Works thereof.
+
+      "Contribution" shall mean any work of authorship, including
+      the original version of the Work and any modifications or additions
+      to that Work or Derivative Works thereof, that is intentionally
+      submitted to Licensor for inclusion in the Work by the copyright owner
+      or by an individual or Legal Entity authorized to submit on behalf of
+      the copyright owner. For the purposes of this definition, "submitted"
+      means any form of electronic, verbal, or written communication sent
+      to the Licensor or its representatives, including but not limited to
+      communication on electronic mailing lists, source code control systems,
+      and issue tracking systems that are managed by, or on behalf of, the
+      Licensor for the purpose of discussing and improving the Work, but
+      excluding communication that is conspicuously marked or otherwise
+      designated in writing by the copyright owner as "Not a Contribution."
+
+      "Contributor" shall mean Licensor and any individual or Legal Entity
+      on behalf of whom a Contribution has been received by Licensor and
+      subsequently incorporated within the Work.
+
+   2. Grant of Copyright License. Subject to the terms and conditions of
+      this License, each Contributor hereby grants to You a perpetual,
+      worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+      copyright license to reproduce, prepare Derivative Works of,
+      publicly display, publicly perform, sublicense, and distribute the
+      Work and such Derivative Works in Source or Object form.
+
+   3. Grant of Patent License. Subject to the terms and conditions of
+      this License, each Contributor hereby grants to You a perpetual,
+      worldwide, non-exclusive, no-charge, royalty-free, irrevocable
+      (except as stated in this section) patent license to make, have made,
+      use, offer to sell, sell, import, and otherwise transfer the Work,
+      where such license applies only to those patent claims licensable
+      by such Contributor that are necessarily infringed by their
+      Contribution(s) alone or by combination of their Contribution(s)
+      with the Work to which such Contribution(s) was submitted. If You
+      institute patent litigation against any entity (including a
+      cross-claim or counterclaim in a lawsuit) alleging that the Work
+      or a Contribution incorporated within the Work constitutes direct
+      or contributory patent infringement, then any patent licenses
+      granted to You under this License for that Work shall terminate
+      as of the date such litigation is filed.
+
+   4. Redistribution. You may reproduce and distribute copies of the
+      Work or Derivative Works thereof in any medium, with or without
+      modifications, and in Source or Object form, provided that You
+      meet the following conditions:
+
+      (a) You must give any other recipients of the Work or
+          Derivative Works a copy of this License; and
+
+      (b) You must cause any modified files to carry prominent notices
+          stating that You changed the files; and
+
+      (c) You must retain, in the Source form of any Derivative Works
+          that You distribute, all copyright, patent, trademark, and
+          attribution notices from the Source form of the Work,
+          excluding those notices that do not pertain to any part of
+          the Derivative Works; and
+
+      (d) If the Work includes a "NOTICE" text file as part of its
+          distribution, then any Derivative Works that You distribute must
+          include a readable copy of the attribution notices contained
+          within such NOTICE file, excluding those notices that do not
+          pertain to any part of the Derivative Works, in at least one
+          of the following places: within a NOTICE text file distributed
+          as part of the Derivative Works; within the Source form or
+          documentation, if provided along with the Derivative Works; or,
+          within a display generated by the Derivative Works, if and
+          wherever such third-party notices normally appear. The contents
+          of the NOTICE file are for informational purposes only and
+          do not modify the License. You may add Your own attribution
+          notices within Derivative Works that You distribute, alongside
+          or as an addendum to the NOTICE text from the Work, provided
+          that such additional attribution notices cannot be construed
+          as modifying the License.
+
+      You may add Your own copyright statement to Your modifications and
+      may provide additional or different license terms and conditions
+      for use, reproduction, or distribution of Your modifications, or
+      for any such Derivative Works as a whole, provided Your use,
+      reproduction, and distribution of the Work otherwise complies with
+      the conditions stated in this License.
+
+   5. Submission of Contributions. Unless You explicitly state otherwise,
+      any Contribution intentionally submitted for inclusion in the Work
+      by You to the Licensor shall be under the terms and conditions of
+      this License, without any additional terms or conditions.
+      Notwithstanding the above, nothing herein shall supersede or modify
+      the terms of any separate license agreement you may have executed
+      with Licensor regarding such Contributions.
+
+   6. Trademarks. This License does not grant permission to use the trade
+      names, trademarks, service marks, or product names of the Licensor,
+      except as required for reasonable and customary use in describing the
+      origin of the Work and reproducing the content of the NOTICE file.
+
+   7. Disclaimer of Warranty. Unless required by applicable law or
+      agreed to in writing, Licensor provides the Work (and each
+      Contributor provides its Contributions) on an "AS IS" BASIS,
+      WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or
+      implied, including, without limitation, any warranties or conditions
+      of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A
+      PARTICULAR PURPOSE. You are solely responsible for determining the
+      appropriateness of using or redistributing the Work and assume any
+      risks associated with Your exercise of permissions under this License.
+
+   8. Limitation of Liability. In no event and under no legal theory,
+      whether in tort (including negligence), contract, or otherwise,
+      unless required by applicable law (such as deliberate and grossly
+      negligent acts) or agreed to in writing, shall any Contributor be
+      liable to You for damages, including any direct, indirect, special,
+      incidental, or consequential damages of any character arising as a
+      result of this License or out of the use or inability to use the
+      Work (including but not limited to damages for loss of goodwill,
+      work stoppage, computer failure or malfunction, or any and all
+      other commercial damages or losses), even if such Contributor
+      has been advised of the possibility of such damages.
+
+   9. Accepting Warranty or Additional Liability. While redistributing
+      the Work or Derivative Works thereof, You may choose to offer,
+      and charge a fee for, acceptance of support, warranty, indemnity,
+      or other liability obligations and/or rights consistent with this
+      License. However, in accepting such obligations, You may act only
+      on Your own behalf and on Your sole responsibility, not on behalf
+      of any other Contributor, and only if You agree to indemnify,
+      defend, and hold each Contributor harmless for any liability
+      incurred by, or claims asserted against, such Contributor by reason
+      of your accepting any such warranty or additional liability.
+
+   END OF TERMS AND CONDITIONS
+
+   APPENDIX: How to apply the Apache License to your work.
+
+      To apply the Apache License to your work, attach the following
+      boilerplate notice, with the fields enclosed by brackets "[]"
+      replaced with your own identifying information. (Don't include
+      the brackets!)  The text should be enclosed in the appropriate
+      comment syntax for the file format. We also recommend that a
+      file or class name and description of purpose be included on the
+      same "printed page" as the copyright notice for easier
+      identification within third-party archives.
+
+   Copyright 2024 Rutger Vos
+
+   Licensed under the Apache License, Version 2.0 (the "License");
+   you may not use this file except in compliance with the License.
+   You may obtain a copy of the License at
+
+       http://www.apache.org/licenses/LICENSE-2.0
+
+   Unless required by applicable law or agreed to in writing, software
+   distributed under the License is distributed on an "AS IS" BASIS,
+   WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+   See the License for the specific language governing permissions and
+   limitations under the License.

edentity-1.4.3/MANIFEST.in

@@ -0,0 +1,33 @@
+# Include Python modules
+recursive-include edentity *.py
+
+# Include only necessary workflow files
+include edentity/workflow/Snakefile
+recursive-include edentity/workflow/rules *.smk
+recursive-include edentity/workflow/scripts *.py
+
+# Include configuration files
+include pyproject.toml
+include README.md
+include LICENSE.md
+include .gitignore
+
+# exclude unnecessary files
+prune edentity/configs
+prune edentity/resources
+prune edentity/workflow/profiles
+prune *.egg-info
+
+# prune git directories
+prune .git
+
+# prune pycharm directories
+prune **/.idea
+# prune test directories
+prune tests
+prune test-data
+
+prune build
+prune dist
+prune __pycache__
+global-exclude *.pyc

edentity-1.4.3/PKG-INFO

@@ -0,0 +1,159 @@
+Metadata-Version: 2.4
+Name: edentity
+Version: 1.4.3
+Summary: A Snakemake-based pipeline for amplicon processing
+Author-email: Luka Lenaroto <luka.lenaroto@naturalis.nl>, Pierre-Etienne Cholley <pierreetienne.cholley@naturalis.nl>, Dick Groenenberg <dick.groenenberg@naturalis.nl>, Edwin den Haas <edwin.denhaas@naturalis.nl>, Dominika Kresa <dominika.kresa@naturalis.nl>, Rutger Vos <rutger.vos@naturalis.nl>
+Classifier: Programming Language :: Python :: 3
+Classifier: Operating System :: OS Independent
+Requires-Python: >=3.10
+Description-Content-Type: text/markdown
+License-File: LICENSE.md
+Requires-Dist: snakemake>=8.16.0
+Requires-Dist: polars>=1.30.0
+Dynamic: license-file
+
+# edentity-metabarcoding-pipeline
+
+![alt text](dag.png)
+
+## Table of Contents
+
+- [Brief on Vsearch](#brief-on-vsearch)
+- [Usage of this workflow](#usage-of-this-workflow)
+    - [Using Conda](#using-conda)
+        - [Install Requirements](#install-requirements)
+            - [Install conda or miniconda](#install-conda-or-miniconda)
+            - [Steps to run edentity-metabarcoding-pipeline](#steps-to-run-edentity-metabarcoding-pipeline)
+    - [Using Docker](#using-docker)
+        - [Install Requirements](#install-requirements-1)
+    - [Deploying to Galaxy](#deploying-to-galaxy)
+        - [Prerequisites](#prerequisites)
+        - [Steps to Deploy](#steps-to-deploy)
+
+# Brief on Vsearch
+
+Vsearch is a metabarcoding pipeline for illumina/AVITI paired-end data. More details can be found at [vsearch github](https://github.com/torognes/vsearch)
+
+
+Vsearch publication: https://doi.org/10.7717/peerj.2584
+
+Technical implementation of this pipeline is inspired by [APSCALE]( https://doi.org/10.1093/bioinformatics/btac588); please cite them if you use this pipeline.
+
+# Usage of this workflow
+
+This workflow can run on:
+
+    - Conda
+
+    - Docker 
+
+    - Galaxy
+
+
+## Using Conda
+
+### Install Requirements
+
+#### Install conda or miniconda
+Ensure (mini)conda is installed on your system. Information on installing miniconda can be found [here](https://docs.anaconda.com/miniconda/)
+
+
+#### Steps to run  edentity-metabarcoding-pipeline
+
+###### 1 Clone this repo
+
+```
+git clone https://gitlab.com/naturalis/bii/bioinformatics/edentity/pipelines/edentity-metabarcoding-pipeline.git && cd edentity-metabarcoding-pipeline/
+
+```
+
+###### 2 Install snakemake conda environment from yaml file 
+```
+conda env create -n snakemake -f workflow/envs/snakemake.yaml
+```
+
+
+###### 3 Activate snakemake conda environment
+
+```
+conda activate snakemake
+```
+
+
+###### 4 Run the workflow: parameters used here are only for example; replace them with params specific to your project.
+
+```
+snakemake -p --profile workflow/profile/ \
+    --config forward_primer=AAACTCGTGCCAGCCACC \
+    reverse_primer=GGGTATCTAATCCCAGTTTG \
+    raw_data_dir=/path/to/your/raw_data/ \
+    work_dir=/path/to/your/work_directory \
+    min_length=200 max_length=600 
+```
+
+Explain parameters and where more info can be found. Link to validation schema.
+
+## Using Docker
+
+### Install Requirements
+
+###### 1. Apptainer:
+Install [apptainer](https://apptainer.org/docs/user/latest/quick_start.html#installation)
+
+
+
+###### 2. Run the workflow:
+
+```
+snakemake -p --profile workflow/profile/ \
+    --config forward_primer=AAACTCGTGCCAGCCACC \
+    reverse_primer=GGGTATCTAATCCCAGTTTG \
+    raw_data_dir=/path/to/your/raw_data/ \
+    work_dir=/path/to/your/work_directory \
+    min_length=200 max_length=600 --use-apptainer
+```
+
+## Deploying to Galaxy
+
+### Prerequisites
+
+Ensure you have access to a Galaxy instance where you have administrative privileges or the ability to install tools and workflows.
+
+### Steps to Deploy
+
+###### 1. Clone the Galaxy branch of this repository
+Clone galaxy branch of this pipeline into your Galaxy tools directory (for Naturalis clone into: `/data/galaxy/local_tools/`)
+
+```
+
+git clone -b galaxy git@gitlab.com:naturalis/bii/bioinformatics/edentity/pipelines/edentity-metabarcoding-pipeline.git
+
+```
+
+###### 2. Configure Galaxy tools xml
+Edit your Galaxy tool configuration xml file to include the `edentity-galaxy-pipeline.xml` file located at the root directory of this repository.
+
+For example to add this pipeline to your galaxy instance: Open `galaxy/config/tool_config.xml`  and add the lines below.
+
+```
+<section id="metabarcoding-pipeline" name="Metabarcoding Pipelines">
+    <tool file="edentity-metabarcoding-pipeline/edentity-galaxy-pipeline.xml"/>
+</section>
+
+```
+
+NB: 
+- Ensure you paste the above lines within `<toolbox> </toolbox>` section in the `galaxy/config/tool_config.xml`
+- Ensure paths are correctly referenced depending on where you cloned the pipeline 
+- Some useful tips on adding custom tools on galaxy can be found [here](https://galaxyproject.org/admin/tools/add-tool-tutorial/)
+
+
+###### 3. Restart Galaxy
+
+Restart your Galaxy instance to load the new tool configuration.
+
+
+###### 4. Running the pipeline on Galaxy:
+Example on how to run this pipeline on Galaxy is available [here](https://gitlab.com/naturalis/bii/bioinformatics/edentity/pipelines/edentity-metabarcoding-pipeline/-/wikis/eDentity-metabarcoding-pipeline)
+
+