dotmatch 0.2.0__tar.gz → 0.2.2__tar.gz

{dotmatch-0.2.0 → dotmatch-0.2.2}/CITATION.cff

@@ -8,8 +8,7 @@ authors:
     orcid: "https://orcid.org/0009-0003-5012-7229"
 repository-code: "https://github.com/dnncha/dotmatch"
 license: Apache-2.0
-version: "0.2.0"
-doi: 10.5281/zenodo.20541628
+version: "0.2.2"
 abstract: "DotMatch is a deterministic known-target short-DNA assignment engine for CRISPR guide counting, barcode demultiplexing, and fixed-target FASTQ workflows."
 keywords:
   - bioinformatics

dotmatch-0.2.2/PKG-INFO

@@ -0,0 +1,285 @@
+Metadata-Version: 2.4
+Name: dotmatch
+Version: 0.2.2
+Summary: Known-target short-DNA assignment from FASTQ for CRISPR guides, barcodes, feature tags, primers, and other targets
+Author: Donncha O'Toole
+License-Expression: Apache-2.0
+Project-URL: Homepage, https://dnncha.github.io/dotmatch/
+Project-URL: Repository, https://github.com/dnncha/dotmatch
+Project-URL: Issues, https://github.com/dnncha/dotmatch/issues
+Project-URL: Documentation, https://dotmatch.readthedocs.io/en/latest/
+Project-URL: Changelog, https://github.com/dnncha/dotmatch/blob/main/CHANGELOG.md
+Keywords: bioinformatics,computational biology,CRISPR,FASTQ,known-target assignment,feature barcodes,sequencing QC,barcode demultiplexing,edit distance
+Classifier: Development Status :: 3 - Alpha
+Classifier: Environment :: Console
+Classifier: Intended Audience :: Science/Research
+Classifier: Programming Language :: C
+Classifier: Programming Language :: Python :: 3
+Classifier: Programming Language :: Python :: 3 :: Only
+Classifier: Programming Language :: Python :: 3.9
+Classifier: Programming Language :: Python :: 3.10
+Classifier: Programming Language :: Python :: 3.11
+Classifier: Programming Language :: Python :: 3.12
+Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
+Requires-Python: >=3.9
+Description-Content-Type: text/markdown
+License-File: LICENSE
+Requires-Dist: tomli; python_version < "3.11"
+Provides-Extra: pandas
+Requires-Dist: pandas>=1.0; extra == "pandas"
+Provides-Extra: anndata
+Requires-Dist: anndata>=0.8; extra == "anndata"
+Requires-Dist: pandas>=1.0; extra == "anndata"
+Provides-Extra: polars
+Requires-Dist: polars>=0.19; extra == "polars"
+Provides-Extra: multiqc
+Requires-Dist: multiqc>=1.20; extra == "multiqc"
+Provides-Extra: dev
+Requires-Dist: pytest; extra == "dev"
+Requires-Dist: pandas>=1.0; extra == "dev"
+Requires-Dist: anndata>=0.8; extra == "dev"
+Requires-Dist: polars>=0.19; extra == "dev"
+Requires-Dist: multiqc>=1.20; extra == "dev"
+Dynamic: license-file
+
+# DotMatch
+
+DotMatch assigns short FASTQ read windows to a known list of DNA sequences. It
+is useful when you already know the guides, barcodes, feature tags, primers, or
+other targets that may be present and want every read reported as a unique
+match, an ambiguous match, unmatched, or invalid.
+
+[![CI](https://github.com/dnncha/dotmatch/actions/workflows/ci.yml/badge.svg)](https://github.com/dnncha/dotmatch/actions/workflows/ci.yml)
+[![PyPI](https://img.shields.io/pypi/v/dotmatch?label=PyPI)](https://pypi.org/project/dotmatch/)
+[![Documentation](https://readthedocs.org/projects/dotmatch/badge/?version=latest)](https://dotmatch.readthedocs.io/en/latest/)
+[![Bioconda](https://img.shields.io/conda/vn/bioconda/dotmatch?label=Bioconda)](https://anaconda.org/bioconda/dotmatch)
+[![License](https://img.shields.io/badge/license-Apache--2.0-blue.svg)](https://github.com/dnncha/dotmatch/blob/main/LICENSE)
+[![DOI](https://zenodo.org/badge/DOI/10.5281/zenodo.20541628.svg)](https://doi.org/10.5281/zenodo.20541628)
+
+[Documentation](https://dotmatch.readthedocs.io/en/latest/) ·
+[Getting started](https://dotmatch.readthedocs.io/en/latest/getting-started.html) ·
+[Command reference](https://dotmatch.readthedocs.io/en/latest/command-reference.html) ·
+[Examples](https://github.com/dnncha/dotmatch/tree/main/examples) ·
+[Citation](https://dotmatch.readthedocs.io/en/latest/methods-and-citation.html)
+
+![FASTQ reads and a target table are compared at a fixed read window. DotMatch writes counts, split FASTQs, QC tables, and reports.](https://raw.githubusercontent.com/dnncha/dotmatch/main/public/dotmatch-read-assignment.svg)
+
+## Install
+
+PyPI is the quickest route on Linux and macOS:
+
+```bash
+python3 -m pip install dotmatch
+dotmatch --version
+```
+
+Conda users can install the current Bioconda build:
+
+```bash
+conda create -n dotmatch -c conda-forge -c bioconda dotmatch
+conda activate dotmatch
+```
+
+The Bioconda recipe supports Linux, Intel macOS, and Apple Silicon
+(`osx-arm64`). If a newly tagged version has not reached Bioconda yet, use the
+PyPI package or install from source.
+
+## A small example
+
+Prepare a tab-separated target file:
+
+```text
+target_id	sequence
+guide_001	ACGTACGTACGTACGTACGT
+guide_002	ACGTACGTACGTACGTAGGT
+```
+
+Then assign a fixed 20-base window from each read:
+
+```bash
+dotmatch count \
+  --targets guides.tsv \
+  --reads sample_R1.fastq.gz \
+  --sample-label sample_1 \
+  --target-start 23 \
+  --target-length 20 \
+  --k 1 \
+  --metric hamming \
+  --out counts.tsv \
+  --sample-qc sample_qc.tsv \
+  --summary summary.json
+```
+
+DotMatch only counts a read when exactly one target is compatible under the
+selected matching rule. Reads that fit several targets remain visible as
+ambiguous instead of being assigned arbitrarily.
+
+## What it is for
+
+- counting CRISPR guides and writing MAGeCK-compatible count tables;
+- demultiplexing fixed-position inline barcodes;
+- assigning feature-barcode and guide-capture reads;
+- checking primer, adapter, amplicon-panel, or whitelist sequences;
+- auditing target lists before enabling mismatch correction;
+- designing and checking barcode panels;
+- writing TSV, JSON, FASTQ, and HTML results for pipelines and lab review.
+
+DotMatch is not a genome aligner, basecaller, UMI pipeline, variant caller, or
+screen-level statistics package. It compares short read windows with a finite
+target list.
+
+## Read outcomes
+
+| Outcome | Meaning |
+| --- | --- |
+| `unique` | Exactly one target is compatible. |
+| `ambiguous` | More than one target is compatible. |
+| `none` | No target is within the selected distance. |
+| `invalid` | The requested read window could not be extracted. |
+
+These states appear in the assignment and QC outputs. They are not folded into
+the unique counts.
+
+## Common workflows
+
+### Count CRISPR guides
+
+For a new screen, DotMatch can prepare a small assay project and infer a likely
+guide window for review:
+
+```bash
+dotmatch crispr quickstart \
+  --library guides.csv \
+  --fastq 'fastqs/*.fastq.gz' \
+  --out crispr_screen/
+```
+
+Review `crispr_screen/inference_report.json` and `assay.toml`, then run:
+
+```bash
+dotmatch assay start crispr_screen/assay.toml
+```
+
+For an explicit one-command run, use `dotmatch crispr-count`. The
+[CRISPR tutorial](https://dotmatch.readthedocs.io/en/latest/tutorials/crispr-count-first-run.html)
+covers both routes.
+
+### Demultiplex inline barcodes
+
+```bash
+dotmatch demux \
+  --barcodes barcodes.tsv \
+  --reads pooled.fastq.gz \
+  --barcode-start 0 \
+  --barcode-length 8 \
+  --k 1 \
+  --metric hamming \
+  --out-dir demuxed/ \
+  --summary demux.summary.json
+```
+
+If a run has an unexpectedly high unmatched or ambiguous rate, inspect it with:
+
+```bash
+dotmatch barcode autopsy \
+  --barcodes barcodes.tsv \
+  --reads pooled.fastq.gz \
+  --scan-starts 0:12 \
+  --k-values 0,1 \
+  --out-dir autopsy/
+```
+
+Open `autopsy/report.html` first. The tables beside it record offset scans,
+near-neighbour barcodes, correction safety, and frequent unmatched windows.
+
+### Check a target library
+
+Before allowing mismatch correction, check whether neighbouring targets can
+produce ambiguous assignments:
+
+```bash
+dotmatch audit \
+  --targets guides.tsv \
+  --k 1 \
+  --audit-mode auto \
+  --out-dir audit/
+```
+
+The [barcode panel guide](https://dotmatch.readthedocs.io/en/latest/barcode-panel-design.html)
+also covers panel design, optimisation, simulation, layout, and export.
+
+## Python API
+
+```python
+import dotmatch
+
+distance = dotmatch.distance("ACGT", "AGGT")
+assert distance == 1
+
+result = dotmatch.assign_posterior("ACGT", ["ACGT", "AGGT"], "IIII")
+print(result.status)
+```
+
+The posterior helper is experimental and is not used by the high-throughput
+CLI path. The [Python API documentation](https://dotmatch.readthedocs.io/en/latest/streaming-api.html)
+describes the supported streaming interfaces.
+
+## Outputs and workflow integration
+
+Depending on the command, DotMatch writes count tables, split FASTQs,
+`sample_qc.tsv`, per-read assignments, unmatched-read tables, `summary.json`,
+and self-contained HTML reports. The formats are documented in the
+[output schema reference](https://dotmatch.readthedocs.io/en/latest/schemas.html).
+
+Examples for Nextflow, nf-core, Snakemake, Galaxy, and MultiQC live under
+[`examples/workflows`](https://github.com/dnncha/dotmatch/tree/main/examples/workflows).
+The desktop Workbench is maintained separately in
+[`dotmatch-community`](https://github.com/dnncha/dotmatch-community).
+
+## Matching rules and performance
+
+Hamming distance is the usual choice for fixed-length windows where only base
+substitutions should be considered. Levenshtein distance can also account for
+short insertions and deletions. The default radius policy requires a single
+compatible target; the optional `best` policy exists for compatibility with
+workflows that select the nearest target.
+
+Indexed candidate generation and native distance kernels make fixed-window
+assignment practical for large FASTQ inputs. Benchmark results, hardware,
+commands, and known limitations are kept with the
+[benchmark reports](https://dotmatch.readthedocs.io/en/latest/benchmarks/README.html).
+Those reports cover the tested workloads; they are not a claim that DotMatch
+replaces general alignment or every demultiplexing workflow.
+
+## Documentation
+
+- [Getting started](https://dotmatch.readthedocs.io/en/latest/getting-started.html)
+- [Command reference](https://dotmatch.readthedocs.io/en/latest/command-reference.html)
+- [AssaySpec workflows](https://dotmatch.readthedocs.io/en/latest/assayspec.html)
+- [CRISPR count QC](https://dotmatch.readthedocs.io/en/latest/crispr-qc.html)
+- [Barcode panel design](https://dotmatch.readthedocs.io/en/latest/barcode-panel-design.html)
+- [Output schemas](https://dotmatch.readthedocs.io/en/latest/schemas.html)
+- [Methods and citation](https://dotmatch.readthedocs.io/en/latest/methods-and-citation.html)
+- [Packaging notes](https://dotmatch.readthedocs.io/en/latest/packaging.html)
+
+## Citation
+
+Run `dotmatch citation` to print the citation for the installed version. The
+repository also includes [`CITATION.cff`](https://github.com/dnncha/dotmatch/blob/main/CITATION.cff),
+and release archives are deposited with Zenodo.
+
+## Development
+
+```bash
+git clone https://github.com/dnncha/dotmatch.git
+cd dotmatch
+make
+make test
+```
+
+See [CONTRIBUTING.md](https://github.com/dnncha/dotmatch/blob/main/CONTRIBUTING.md)
+for the development setup and pull-request checks.
+
+## License
+
+Apache-2.0. See [LICENSE](https://github.com/dnncha/dotmatch/blob/main/LICENSE).

dotmatch-0.2.2/README.md

@@ -0,0 +1,241 @@
+# DotMatch
+
+DotMatch assigns short FASTQ read windows to a known list of DNA sequences. It
+is useful when you already know the guides, barcodes, feature tags, primers, or
+other targets that may be present and want every read reported as a unique
+match, an ambiguous match, unmatched, or invalid.
+
+[![CI](https://github.com/dnncha/dotmatch/actions/workflows/ci.yml/badge.svg)](https://github.com/dnncha/dotmatch/actions/workflows/ci.yml)
+[![PyPI](https://img.shields.io/pypi/v/dotmatch?label=PyPI)](https://pypi.org/project/dotmatch/)
+[![Documentation](https://readthedocs.org/projects/dotmatch/badge/?version=latest)](https://dotmatch.readthedocs.io/en/latest/)
+[![Bioconda](https://img.shields.io/conda/vn/bioconda/dotmatch?label=Bioconda)](https://anaconda.org/bioconda/dotmatch)
+[![License](https://img.shields.io/badge/license-Apache--2.0-blue.svg)](https://github.com/dnncha/dotmatch/blob/main/LICENSE)
+[![DOI](https://zenodo.org/badge/DOI/10.5281/zenodo.20541628.svg)](https://doi.org/10.5281/zenodo.20541628)
+
+[Documentation](https://dotmatch.readthedocs.io/en/latest/) ·
+[Getting started](https://dotmatch.readthedocs.io/en/latest/getting-started.html) ·
+[Command reference](https://dotmatch.readthedocs.io/en/latest/command-reference.html) ·
+[Examples](https://github.com/dnncha/dotmatch/tree/main/examples) ·
+[Citation](https://dotmatch.readthedocs.io/en/latest/methods-and-citation.html)
+
+![FASTQ reads and a target table are compared at a fixed read window. DotMatch writes counts, split FASTQs, QC tables, and reports.](https://raw.githubusercontent.com/dnncha/dotmatch/main/public/dotmatch-read-assignment.svg)
+
+## Install
+
+PyPI is the quickest route on Linux and macOS:
+
+```bash
+python3 -m pip install dotmatch
+dotmatch --version
+```
+
+Conda users can install the current Bioconda build:
+
+```bash
+conda create -n dotmatch -c conda-forge -c bioconda dotmatch
+conda activate dotmatch
+```
+
+The Bioconda recipe supports Linux, Intel macOS, and Apple Silicon
+(`osx-arm64`). If a newly tagged version has not reached Bioconda yet, use the
+PyPI package or install from source.
+
+## A small example
+
+Prepare a tab-separated target file:
+
+```text
+target_id	sequence
+guide_001	ACGTACGTACGTACGTACGT
+guide_002	ACGTACGTACGTACGTAGGT
+```
+
+Then assign a fixed 20-base window from each read:
+
+```bash
+dotmatch count \
+  --targets guides.tsv \
+  --reads sample_R1.fastq.gz \
+  --sample-label sample_1 \
+  --target-start 23 \
+  --target-length 20 \
+  --k 1 \
+  --metric hamming \
+  --out counts.tsv \
+  --sample-qc sample_qc.tsv \
+  --summary summary.json
+```
+
+DotMatch only counts a read when exactly one target is compatible under the
+selected matching rule. Reads that fit several targets remain visible as
+ambiguous instead of being assigned arbitrarily.
+
+## What it is for
+
+- counting CRISPR guides and writing MAGeCK-compatible count tables;
+- demultiplexing fixed-position inline barcodes;
+- assigning feature-barcode and guide-capture reads;
+- checking primer, adapter, amplicon-panel, or whitelist sequences;
+- auditing target lists before enabling mismatch correction;
+- designing and checking barcode panels;
+- writing TSV, JSON, FASTQ, and HTML results for pipelines and lab review.
+
+DotMatch is not a genome aligner, basecaller, UMI pipeline, variant caller, or
+screen-level statistics package. It compares short read windows with a finite
+target list.
+
+## Read outcomes
+
+| Outcome | Meaning |
+| --- | --- |
+| `unique` | Exactly one target is compatible. |
+| `ambiguous` | More than one target is compatible. |
+| `none` | No target is within the selected distance. |
+| `invalid` | The requested read window could not be extracted. |
+
+These states appear in the assignment and QC outputs. They are not folded into
+the unique counts.
+
+## Common workflows
+
+### Count CRISPR guides
+
+For a new screen, DotMatch can prepare a small assay project and infer a likely
+guide window for review:
+
+```bash
+dotmatch crispr quickstart \
+  --library guides.csv \
+  --fastq 'fastqs/*.fastq.gz' \
+  --out crispr_screen/
+```
+
+Review `crispr_screen/inference_report.json` and `assay.toml`, then run:
+
+```bash
+dotmatch assay start crispr_screen/assay.toml
+```
+
+For an explicit one-command run, use `dotmatch crispr-count`. The
+[CRISPR tutorial](https://dotmatch.readthedocs.io/en/latest/tutorials/crispr-count-first-run.html)
+covers both routes.
+
+### Demultiplex inline barcodes
+
+```bash
+dotmatch demux \
+  --barcodes barcodes.tsv \
+  --reads pooled.fastq.gz \
+  --barcode-start 0 \
+  --barcode-length 8 \
+  --k 1 \
+  --metric hamming \
+  --out-dir demuxed/ \
+  --summary demux.summary.json
+```
+
+If a run has an unexpectedly high unmatched or ambiguous rate, inspect it with:
+
+```bash
+dotmatch barcode autopsy \
+  --barcodes barcodes.tsv \
+  --reads pooled.fastq.gz \
+  --scan-starts 0:12 \
+  --k-values 0,1 \
+  --out-dir autopsy/
+```
+
+Open `autopsy/report.html` first. The tables beside it record offset scans,
+near-neighbour barcodes, correction safety, and frequent unmatched windows.
+
+### Check a target library
+
+Before allowing mismatch correction, check whether neighbouring targets can
+produce ambiguous assignments:
+
+```bash
+dotmatch audit \
+  --targets guides.tsv \
+  --k 1 \
+  --audit-mode auto \
+  --out-dir audit/
+```
+
+The [barcode panel guide](https://dotmatch.readthedocs.io/en/latest/barcode-panel-design.html)
+also covers panel design, optimisation, simulation, layout, and export.
+
+## Python API
+
+```python
+import dotmatch
+
+distance = dotmatch.distance("ACGT", "AGGT")
+assert distance == 1
+
+result = dotmatch.assign_posterior("ACGT", ["ACGT", "AGGT"], "IIII")
+print(result.status)
+```
+
+The posterior helper is experimental and is not used by the high-throughput
+CLI path. The [Python API documentation](https://dotmatch.readthedocs.io/en/latest/streaming-api.html)
+describes the supported streaming interfaces.
+
+## Outputs and workflow integration
+
+Depending on the command, DotMatch writes count tables, split FASTQs,
+`sample_qc.tsv`, per-read assignments, unmatched-read tables, `summary.json`,
+and self-contained HTML reports. The formats are documented in the
+[output schema reference](https://dotmatch.readthedocs.io/en/latest/schemas.html).
+
+Examples for Nextflow, nf-core, Snakemake, Galaxy, and MultiQC live under
+[`examples/workflows`](https://github.com/dnncha/dotmatch/tree/main/examples/workflows).
+The desktop Workbench is maintained separately in
+[`dotmatch-community`](https://github.com/dnncha/dotmatch-community).
+
+## Matching rules and performance
+
+Hamming distance is the usual choice for fixed-length windows where only base
+substitutions should be considered. Levenshtein distance can also account for
+short insertions and deletions. The default radius policy requires a single
+compatible target; the optional `best` policy exists for compatibility with
+workflows that select the nearest target.
+
+Indexed candidate generation and native distance kernels make fixed-window
+assignment practical for large FASTQ inputs. Benchmark results, hardware,
+commands, and known limitations are kept with the
+[benchmark reports](https://dotmatch.readthedocs.io/en/latest/benchmarks/README.html).
+Those reports cover the tested workloads; they are not a claim that DotMatch
+replaces general alignment or every demultiplexing workflow.
+
+## Documentation
+
+- [Getting started](https://dotmatch.readthedocs.io/en/latest/getting-started.html)
+- [Command reference](https://dotmatch.readthedocs.io/en/latest/command-reference.html)
+- [AssaySpec workflows](https://dotmatch.readthedocs.io/en/latest/assayspec.html)
+- [CRISPR count QC](https://dotmatch.readthedocs.io/en/latest/crispr-qc.html)
+- [Barcode panel design](https://dotmatch.readthedocs.io/en/latest/barcode-panel-design.html)
+- [Output schemas](https://dotmatch.readthedocs.io/en/latest/schemas.html)
+- [Methods and citation](https://dotmatch.readthedocs.io/en/latest/methods-and-citation.html)
+- [Packaging notes](https://dotmatch.readthedocs.io/en/latest/packaging.html)
+
+## Citation
+
+Run `dotmatch citation` to print the citation for the installed version. The
+repository also includes [`CITATION.cff`](https://github.com/dnncha/dotmatch/blob/main/CITATION.cff),
+and release archives are deposited with Zenodo.
+
+## Development
+
+```bash
+git clone https://github.com/dnncha/dotmatch.git
+cd dotmatch
+make
+make test
+```
+
+See [CONTRIBUTING.md](https://github.com/dnncha/dotmatch/blob/main/CONTRIBUTING.md)
+for the development setup and pull-request checks.
+
+## License
+
+Apache-2.0. See [LICENSE](https://github.com/dnncha/dotmatch/blob/main/LICENSE).

{dotmatch-0.2.0 → dotmatch-0.2.2}/codemeta.json

@@ -2,15 +2,15 @@
   "@context": "https://doi.org/10.5063/schema/codemeta-2.0",
   "@type": "SoftwareSourceCode",
   "name": "DotMatch",
-  "description": "Deterministic short-DNA known-target matching and QC for CRISPR guides, barcodes, primers, panels, and whitelist-style target sets.",
+  "description": "Assign short FASTQ read windows to known CRISPR guides, barcodes, feature tags, primers, and other DNA targets.",
   "applicationCategory": "Bioinformatics",
   "url": "https://github.com/dnncha/dotmatch",
   "codeRepository": "https://github.com/dnncha/dotmatch",
   "issueTracker": "https://github.com/dnncha/dotmatch/issues",
   "license": "https://spdx.org/licenses/Apache-2.0",
   "identifier": "https://doi.org/10.5281/zenodo.20541628",
-  "version": "0.2.0",
-  "softwareVersion": "0.2.0",
+  "version": "0.2.2",
+  "softwareVersion": "0.2.2",
   "programmingLanguage": [
     "C",
     "Python",
@@ -43,6 +43,6 @@
     "Python >=3.9",
     "zlib"
   ],
-  "readme": "https://dotmatch.readthedocs.io/",
+  "readme": "https://dotmatch.readthedocs.io/en/latest/",
   "citation": "https://github.com/dnncha/dotmatch/blob/main/CITATION.cff"
 }

{dotmatch-0.2.0 → dotmatch-0.2.2}/include/qdalign.h

@@ -7,7 +7,7 @@
 extern "C" {
 #endif
 
-#define QDALN_VERSION "0.2.0"
+#define QDALN_VERSION "0.2.2"
 #define QDALN_ALPHABET_POLICY "literal-byte; A/C/G/T/N/IUPAC symbols are ordinary byte symbols; no wildcard expansion"
 
 enum qdaln_match_status {

{dotmatch-0.2.0 → dotmatch-0.2.2}/pyproject.toml

@@ -4,8 +4,8 @@ build-backend = "setuptools.build_meta"
 
 [project]
 name = "dotmatch"
-version = "0.2.0"
-description = "AssayCode workflows and the DotMatch engine for auditable known-target short-DNA assignment across CRISPR, barcode, and FASTQ assays"
+version = "0.2.2"
+description = "Known-target short-DNA assignment from FASTQ for CRISPR guides, barcodes, feature tags, primers, and other targets"
 readme = "README.md"
 requires-python = ">=3.9"
 dependencies = [
@@ -22,8 +22,8 @@ keywords = [
     "CRISPR",
     "FASTQ",
     "known-target assignment",
-    "assay compiler",
-    "assay QC",
+    "feature barcodes",
+    "sequencing QC",
     "barcode demultiplexing",
     "edit distance",
 ]
@@ -49,10 +49,11 @@ multiqc = ["multiqc>=1.20"]
 dev = ["pytest", "pandas>=1.0", "anndata>=0.8", "polars>=0.19", "multiqc>=1.20"]
 
 [project.urls]
-Homepage = "https://github.com/dnncha/dotmatch"
+Homepage = "https://dnncha.github.io/dotmatch/"
 Repository = "https://github.com/dnncha/dotmatch"
 Issues = "https://github.com/dnncha/dotmatch/issues"
-Documentation = "https://dotmatch.readthedocs.io/"
+Documentation = "https://dotmatch.readthedocs.io/en/latest/"
+Changelog = "https://github.com/dnncha/dotmatch/blob/main/CHANGELOG.md"
 
 [tool.setuptools]
 package-dir = {"" = "python"}

{dotmatch-0.2.0 → dotmatch-0.2.2}/python/dotmatch/__init__.py

@@ -52,7 +52,7 @@ def _source_tree_version() -> Optional[str]:
 try:
     __version__ = _source_tree_version() or _metadata_version("dotmatch")
 except PackageNotFoundError:
-    __version__ = "0.2.0"
+    __version__ = "0.2.2"
 
 __all__ = [
     "__version__",