codext 1.16.5__tar.gz → 2.0.1__tar.gz

codext-2.0.1/.github/dependabot.yml

@@ -0,0 +1,15 @@
+version: 2
+updates:
+  - package-ecosystem: github-actions
+    directory: /
+    schedule:
+      interval: monthly
+    groups:
+      actions:
+        patterns: ["*"]
+  - package-ecosystem: pip
+    directory: /
+    schedule:
+      interval: monthly
+    # dependencies are minimum versions (>=) ; only open security updates, not routine upgrades
+    open-pull-requests-limit: 0

codext-2.0.1/.github/workflows/python-package.yml

@@ -0,0 +1,141 @@
+# This workflow will install Python dependencies, run tests and lint with a variety of Python versions
+# For more information see: https://docs.github.com/en/actions/automating-builds-and-tests/building-and-testing-python
+
+name: build
+
+on:
+  push:
+    branches: [ "main" ]
+  pull_request:
+    branches: [ "main" ]
+
+permissions:
+  contents: read
+
+jobs:
+  prepare:
+    runs-on: ubuntu-latest
+    outputs:
+      package: ${{ steps.pkg.outputs.package }}
+      pypi_url: ${{ steps.pkg.outputs.pypi_url }}
+    steps:
+      - name: Compute package name from the repository's
+        id: pkg
+        run: |
+          name="${GITHUB_REPOSITORY##*/}"
+          echo "package=${name#python-}" >> $GITHUB_OUTPUT
+          echo "pypi_url=https://pypi.org/p/${name#python-}" >> $GITHUB_OUTPUT
+  build:
+    needs: prepare
+    runs-on: ${{ matrix.os }}
+    strategy:
+      fail-fast: false
+      matrix:
+        os: [ubuntu-latest]
+        python-version: ["3.10", "3.11", "3.12", "3.13"]
+    env:
+      package: ${{ needs.prepare.outputs.package }}
+      cov_python_version: "3.13"
+    steps:
+    - uses: actions/checkout@v7
+    - name: Set up Python ${{ matrix.python-version }}
+      uses: actions/setup-python@v7
+      with:
+        python-version: ${{ matrix.python-version }}
+    - name: Install ${{ env.package }}
+      run: |
+        python -m pip install --upgrade pip
+        python -m pip install pytest pytest-cov
+        pip install -r requirements.txt
+        pip install "tinyscript>=1.31"
+        pip install .[bcrypt]
+    - name: Test ${{ env.package }} with pytest
+      run: |
+        pytest --cov=$package --cov-report=xml
+    - name: Upload coverage report
+      if: matrix.python-version == env.cov_python_version
+      uses: actions/upload-artifact@v7
+      with:
+        name: coverage-report
+        path: coverage.xml
+  coverage:
+    # only publish the badge for commits on main (not for pull requests)
+    if: github.event_name == 'push' && github.ref == 'refs/heads/main'
+    needs: build
+    permissions:
+      contents: write
+    runs-on: ubuntu-latest
+    env:
+      cov_badge_path: docs/coverage.svg
+    steps:
+    - uses: actions/checkout@v7
+    - name: Set up Python
+      uses: actions/setup-python@v7
+      with:
+        python-version: "3.13"
+    - name: Download coverage report
+      uses: actions/download-artifact@v8
+      with:
+        name: coverage-report
+    - name: Make coverage badge
+      run: |
+        pip install genbadge[coverage]
+        genbadge coverage -i coverage.xml -o $cov_badge_path
+    - name: Push coverage badge
+      run: |
+        # keep the badge alone on an orphan branch so that main is never modified by the workflow
+        git config --local user.email "github-actions[bot]@users.noreply.github.com"
+        git config --local user.name "github-actions[bot]"
+        if git fetch --depth=1 origin coverage-badge 2>/dev/null && \
+           git show FETCH_HEAD:$cov_badge_path | cmp -s - $cov_badge_path; then
+          echo "Coverage badge unchanged"
+          exit 0
+        fi
+        git checkout --orphan coverage-badge
+        git rm -rqf --cached .
+        git add $cov_badge_path
+        git commit -m "Update coverage badge"
+        git push origin coverage-badge --force
+  deploy:
+    # only release from main, never from pull requests
+    if: github.event_name == 'push' && github.ref == 'refs/heads/main'
+    environment:
+      name: pypi
+      url: ${{ needs.prepare.outputs.pypi_url }}
+    permissions:
+      contents: read
+      id-token: write  # for PyPI trusted publishing (OIDC)
+    runs-on: ubuntu-latest
+    needs: [prepare, build]
+    env:
+      package: ${{ needs.prepare.outputs.package }}
+    steps:
+    - uses: actions/checkout@v7
+    - name: Check whether the version is already on PyPI
+      # comparing with PyPI (not with the previous commit) also releases a version whose push did not trigger a deploy
+      id: version
+      run: |
+        version=$(tr -d '[:space:]' < src/$package/VERSION.txt)
+        status=$(curl -s -o /dev/null -w '%{http_code}' --retry 3 "https://pypi.org/pypi/$package/$version/json")
+        case "$status" in
+          200) echo "Version $version is already on PyPI" ; echo "new=false" >> "$GITHUB_OUTPUT" ;;
+          404) echo "Version $version is not on PyPI yet" ; echo "new=true" >> "$GITHUB_OUTPUT" ;;
+          *)   echo "::error::Unexpected HTTP status $status from PyPI" ; exit 1 ;;
+        esac
+    - if: steps.version.outputs.new == 'true'
+      name: Set up Python
+      uses: actions/setup-python@v7
+      with:
+        python-version: "3.13"
+    - if: steps.version.outputs.new == 'true'
+      name: Cleanup README
+      run: |
+        sed -ri 's/^(##*)\s*:.*:\s*/\1 /g' README.md
+        awk '{if (match($0,"## Supporters")) exit; print}' README.md > README
+        mv -f README README.md
+    - if: steps.version.outputs.new == 'true'
+      name: Build ${{ needs.prepare.outputs.package }} package
+      run: python -m pip install --upgrade build && python -m build
+    - if: steps.version.outputs.new == 'true'
+      name: Publish to PyPI
+      uses: pypa/gh-action-pypi-publish@release/v1

codext-2.0.1/.github/workflows/security.yml

@@ -0,0 +1,31 @@
+# This workflow audits the project's dependencies for known vulnerabilities
+# It is separate from python-package.yml so that a new advisory never blocks a release
+
+name: security
+
+on:
+  push:
+    branches: [ "main" ]
+  pull_request:
+    branches: [ "main" ]
+  schedule:
+    - cron: "0 6 * * 1"  # weekly, catches new advisories between pushes
+  workflow_dispatch:
+
+permissions:
+  contents: read
+
+jobs:
+  pip-audit:
+    runs-on: ubuntu-latest
+    steps:
+    - uses: actions/checkout@v7
+    - name: Set up Python
+      uses: actions/setup-python@v7
+      with:
+        python-version: "3.13"
+    - name: Install pip-audit
+      run: python -m pip install --upgrade pip pip-audit
+    - name: Audit dependencies
+      # audit the project path (not the environment) so that the runner's own packages are not reported
+      run: pip-audit .

codext-1.16.5/.readthedocs.yml → codext-2.0.1/.readthedocs.yaml

@@ -1,9 +1,9 @@
 version: 2
 
 build:
-  os: "ubuntu-22.04"
+  os: ubuntu-24.04
   tools:
-    python: "3.11"
+    python: "3.13"
 
 mkdocs:
   configuration: docs/mkdocs.yml

{codext-1.16.5 → codext-2.0.1}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: codext
-Version: 1.16.5
+Version: 2.0.1
 Summary: Native codecs extension
 Author-email: Alexandre D'Hondt <alexandre.dhondt@gmail.com>
 License:                     GNU GENERAL PUBLIC LICENSE
@@ -689,11 +689,16 @@ Classifier: Intended Audience :: Developers
 Classifier: License :: OSI Approved :: GNU General Public License v3 or later (GPLv3+)
 Classifier: Programming Language :: Python :: 3
 Classifier: Topic :: Software Development :: Libraries :: Python Modules
-Requires-Python: <4,>=3.8
+Requires-Python: <4,>=3.10
 Description-Content-Type: text/markdown
 License-File: LICENSE
+Requires-Dist: backports.zstd; python_version < "3.14"
 Requires-Dist: legacycrypt; python_version >= "3.13"
 Requires-Dist: markdown2>=2.5.4
+Provides-Extra: argon2
+Requires-Dist: argon2-cffi>=21.0.0; extra == "argon2"
+Provides-Extra: bcrypt
+Requires-Dist: bcrypt>=4.0.0; extra == "bcrypt"
 Dynamic: license-file
 
 <p align="center" id="top"><img src="https://github.com/dhondta/python-codext/raw/main/docs/pages/img/logo.png"></p>
@@ -701,15 +706,15 @@ Dynamic: license-file
 <h3 align="center">Encode/decode anything.</h3>
 
 [![PyPi](https://img.shields.io/pypi/v/codext.svg)](https://pypi.python.org/pypi/codext/)
+[![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
 [![Read The Docs](https://readthedocs.org/projects/python-codext/badge/?version=latest)](https://python-codext.readthedocs.io/en/latest/?badge=latest)
 [![Build Status](https://github.com/dhondta/python-codext/actions/workflows/python-package.yml/badge.svg)](https://github.com/dhondta/python-codext/actions/workflows/python-package.yml)
+[![Security](https://github.com/dhondta/python-codext/actions/workflows/security.yml/badge.svg)](https://github.com/dhondta/python-codext/actions/workflows/security.yml)
 [![Coverage Status](https://raw.githubusercontent.com/dhondta/python-codext/coverage-badge/docs/coverage.svg)](#)
-[![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
-[![Known Vulnerabilities](https://snyk.io/test/github/dhondta/python-codext/badge.svg?targetFile=requirements.txt)](https://snyk.io/test/github/dhondta/python-codext?targetFile=requirements.txt)
 [![DOI](https://zenodo.org/badge/236679865.svg)](https://zenodo.org/badge/latestdoi/236679865)
 [![License](https://img.shields.io/pypi/l/codext.svg)](https://pypi.python.org/pypi/codext/)
 
-[**CodExt**](https://github.com/dhondta/python-codext) is a (Python2-3 compatible) library that extends the native [`codecs`](https://docs.python.org/3/library/codecs) library (namely for adding new custom encodings and character mappings) and provides **120+ new codecs**, hence its name combining *CODecs EXTension*. It also features a **guess mode** for decoding multiple layers of encoding and **CLI tools** for convenience.
+[**CodExt**](https://github.com/dhondta/python-codext) is a library (Python 3.10 or later) that extends the native [`codecs`](https://docs.python.org/3/library/codecs) library (namely for adding new custom encodings and character mappings) and provides **150+ new codecs**, hence its name combining *CODecs EXTension*. It also features a **guess mode** for decoding multiple layers of encoding and **CLI tools** for convenience.
 
 ```sh
 $ pip install codext
@@ -717,7 +722,7 @@ $ pip install codext
 
 Want to contribute a new codec ?    |     Want to contribute a new macro ?
 :----------------------------------:|:------------------------------------:
-Check the [documentation](https://python-codext.readthedocs.io/en/latest/howto) first<br>Then [PR](https://github.com/dhondta/python-codext/pulls) your new codec | [PR](https://github.com/dhondta/python-codext/pulls) your updated version of [`macros.json`](https://github.com/dhondta/python-codext/blob/main/codext/macros.json)
+Check the [documentation](https://python-codext.readthedocs.io/en/latest/howto.html) first<br>Then [PR](https://github.com/dhondta/python-codext/pulls) your new codec | [PR](https://github.com/dhondta/python-codext/pulls) your updated version of [`macros.json`](https://github.com/dhondta/python-codext/blob/main/src/codext/macros.json)
 
 ## Demonstrations
 
@@ -957,7 +962,15 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 
 ## List of codecs
 
-#### [BaseXX](https://python-codext.readthedocs.io/en/latest/enc/base)
+#### [Barcodes](https://python-codext.readthedocs.io/en/latest/enc/barcodes.html)
+
+- [X] `aztec`: real (scannable) Aztec code (ISO/IEC 24778) ; optimal high-level compaction, error correction percentage given in the name (e.g. `aztec-33` ; 23% by default), rendered as an image or, with `aztec-text`, as plain text ; decoding applies Reed-Solomon error correction
+- [X] `datamatrix`: real (scannable) Data Matrix barcode (ISO/IEC 16022, ECC200) ; most compact of the ASCII, C40, Text, X12 and EDIFACT schemes, square or rectangular (`datamatrix-rect`), rendered as an image or, with `datamatrix-text`, as plain text ; decoding applies Reed-Solomon error correction
+- [X] `fakeqr`: hides the input bits as the modules of something that looks like a QR code but is not one, either an image or, with the `fakeqr-text` variant, plain text (the 8 QR masks are available as `fakeqr-0` to `fakeqr-7`)
+- [X] `pdf417`: real (scannable) PDF417 stacked barcode (ISO/IEC 15438) ; most compact of the Text, Byte and Numeric modes, error correction level given in the name (e.g. `pdf417-5` ; 2 by default), rendered as an image or, with `pdf417-text`, as plain text ; decoding applies Reed-Solomon error correction
+- [X] `qr`: real (scannable) QR code ; byte mode, error correction level given in the name (`qr-l`, `qr-m`, `qr-q`, `qr-h` ; M by default), rendered as an image or, with `qr-text`, as plain text ; decoding applies Reed-Solomon error correction
+
+#### [BaseXX](https://python-codext.readthedocs.io/en/latest/enc/base.html)
 
 - [X] `base1`: useless, but for the sake of completeness
 - [X] `base2`: simple conversion to binary (with a variant with a reversed alphabet)
@@ -970,21 +983,33 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 - [X] `base26`: conversion to alphabet letters
 - [X] `base32`: classical conversion according to the RFC4648 with all its variants ([zbase32](https://philzimmermann.com/docs/human-oriented-base-32-encoding.txt), extended hexadecimal, [geohash](https://en.wikipedia.org/wiki/Geohash), [Crockford](https://www.crockford.com/base32))
 - [X] `base36`: [Base36](https://en.wikipedia.org/wiki/Base36) conversion to letters and digits (with a variant inverting both groups)
+- [X] `base38`: [Base38](https://github.com/project-chip/connectedhomeip/blob/master/src/setup_payload/Base38Encode.cpp) encoding of the Matter setup QR codes (chunks of 3 bytes)
 - [X] `base45`: [Base45](https://datatracker.ietf.org/doc/html/draft-faltstrom-base45-04.txt) DRAFT algorithm (with a variant inverting letters and digits)
 - [X] `base58`: multiple versions of [Base58](https://en.bitcoinwiki.org/wiki/Base58) (bitcoin, flickr, ripple)
 - [X] `base62`: [Base62](https://en.wikipedia.org/wiki/Base62) conversion to lower- and uppercase letters and digits (with a variant with letters and digits inverted)
 - [X] `base63`: similar to `base62` with the "`_`" added
 - [X] `base64`: classical conversion according to RFC4648 with its variant URL (or *file*) (it also holds a variant with letters and digits inverted)
 - [X] `base67`: custom conversion using some more special characters (also with a variant with letters and digits inverted)
+- [X] `base69`: [Base69](https://github.com/pshihn/base69) encoding (chunks of 7 bytes, 2 characters per 7 bits)
 - [X] `base85`: all variants of Base85 ([Ascii85](https://fr.wikipedia.org/wiki/Ascii85), [z85](https://rfc.zeromq.org/spec/32), [Adobe](https://dencode.com/string/ascii85), [(x)btoa](https://dencode.com/string/ascii85), [RFC1924](https://datatracker.ietf.org/doc/html/rfc1924), [XML](https://datatracker.ietf.org/doc/html/draft-kwiatkowski-base85-for-xml-00))
 - [X] `base91`: [Base91](http://base91.sourceforge.net) custom conversion
 - [X] `base100` (or *emoji*): [Base100](https://github.com/AdamNiederer/base100) custom conversion
-- [X] `base122`: [Base100](http://blog.kevinalbs.com/base122) custom conversion
-- [X] `base-genericN`: see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base) ; supports any possible base
+- [X] `base122`: [Base122](http://blog.kevinalbs.com/base122) custom conversion
+- [X] `base128`: conversion to the ASCII charset (with control characters)
+- [X] `base128-latin1`: [Base128](https://github.com/rpuntaie/base128) with printable characters (digits, letters and Latin-1)
+- [X] `base256`: [Base256](https://github.com/KvanTTT/BaseNcoding) with one printable character per byte
+- [X] `base1024` (or *ecoji*): [Ecoji](https://github.com/keith-turner/ecoji) custom conversion (10 bits per emoji, versions 1 and 2)
+- [X] `base2048`: [Base2048](https://github.com/qntm/base2048) custom conversion (11 bits per character, optimised for Twitter)
+- [X] `base32768`: [Base32768](https://github.com/qntm/base32768) custom conversion (15 bits per character, optimised for UTF-16)
+- [X] `base65536`: [Base65536](https://github.com/qntm/base65536) custom conversion (16 bits per character, optimised for UTF-32)
+- [X] `base131072`: Base131072 conversion (17 bits per character), as implemented by the [base131072](https://docs.rs/base131072) Rust crate
+- [X] `bech32`: [Bech32](https://github.com/bitcoin/bips/blob/master/bip-0173.mediawiki) encoding with a human-readable part ; `bech32m` for its [Bech32m](https://github.com/bitcoin/bips/blob/master/bip-0350.mediawiki) variant
+- [X] `leb128` (or *varint*): [LEB128](https://en.wikipedia.org/wiki/LEB128) encoding of lists of integers ; `sleb128` for its signed variant
+- [X] `base-genericN`: see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base.html) ; supports any possible base
 
 This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `base85` codec.
 
-#### [Binary](https://python-codext.readthedocs.io/en/latest/enc/binary)
+#### [Binary](https://python-codext.readthedocs.io/en/latest/enc/binary.html)
 
 - [X] `baudot`: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
 - [X] `baudot-spaced`: variant of `baudot` ; groups of 5 bits are whitespace-separated
@@ -992,19 +1017,68 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `bcd`: _Binary Coded Decimal_, encodes characters from their (zero-left-padded) ordinals
 - [X] `bcd-extended0`: variant of `bcd` ; encodes characters from their (zero-left-padded) ordinals using prefix bits `0000`
 - [X] `bcd-extended1`: variant of `bcd` ; encodes characters from their (zero-left-padded) ordinals using prefix bits `1111`
+- [X] `chuck-norris`: Chuck Norris unary code (runs of the 7-bit ASCII bits written with blocks of zeros)
+- [X] `differential-manchester`: line code writing the bits as transitions at the start of their periods (also inverted)
+- [X] `elias-gamma`, `elias-delta`: Elias universal codes, encoding characters from their ordinals (or lists of integers with `-integers`)
 - [X] `excess3`: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
+- [X] `fibonacci`: Fibonacci universal code, encoding characters from their ordinals (or lists of integers with `-integers`)
 - [X] `gray`: aka reflected binary code
+- [X] `hamming`: Hamming(7,4) error-correcting code, correcting single-bit errors (and detecting double-bit errors with `hamming84`)
 - [X] `manchester`: XORes each bit of the input with `01`
 - [X] `manchester-inverted`: variant of `manchester` ; XORes each bit of the input with `10`
+- [X] `nrzi`: Non-Return-to-Zero Inverted line code, writing 1 (or 0 with `nrzi-space`) as a transition
 - [X] `rotateN`: rotates characters by the specified number of bits (*N* belongs to [1, 7] ; Python 3 only)
 
-#### [Checksums](https://python-codext.readthedocs.io/en/latest/enc/checksums)
+#### [Checksums](https://python-codext.readthedocs.io/en/latest/enc/hashing.html#checksums)
 
 - [X] `adler`: Adler32 algorithm (relies on `zlib`)
 - [X] `crc`: CRC of lengths 8, 10-17, 21, 24, 30-32, 40, 64, 82 with a variety of polynoms
+- [X] `fletcher`: Fletcher-16, -32 and -64 checksums
 - [X] `luhn`: Luhn mod N algorithm
 
-#### [Common](https://python-codext.readthedocs.io/en/latest/enc/common)
+#### [Ciphers](https://python-codext.readthedocs.io/en/latest/enc/ciphers.html)
+
+- [X] `adfgx`: aka ADFGX Cipher (Polybius square and columnar transposition) ; `adfgvx` for its 6x6 variant
+- [X] `aer256`: aka AER-256 (toy cipher with float arithmetic, from online JavaScript tools)
+- [X] `affine`: aka Affine Cipher
+- [X] `armon64`: aka ARMON-64 (variant of AER-256 with a fourth operation)
+- [X] `atbash`: aka Atbash Cipher
+- [X] `autoclave`: aka Autoclave/Autokey Cipher (variant of Vigenere Cipher)
+- [X] `bacon`: aka Baconian Cipher
+- [X] `barbie-N`: aka Barbie Typewriter (*N* belongs to [1, 4])
+- [X] `bazeries`: aka Bazeries Cipher (two Polybius grids and a transposition keyed by a number)
+- [X] `beaufort`: aka Beaufort Cipher (variant of Vigenere Cipher)
+- [X] `bifid`: aka Bifid Cipher (Delastelle's fractionation with a 5x5 Polybius square) ; `trifid` for its 3x3x3 cube variant
+- [X] `chaocipher`: aka Chaocipher (two alphabets permuted after each letter)
+- [X] `columnar`: aka Columnar Transposition Cipher (keyword-ordered columns ; a second keyword gives the double transposition)
+- [X] `enigma`: aka Enigma machine (Enigma I, M3 and M4, with reflector, rotors, rings, positions and plugboard)
+- [X] `ezip64`: aka EZIP-64 (variant of ARMON-64 with smaller blocks)
+- [X] `foursquare`: aka Four-square Cipher (bigrams substituted with two keyed squares and two plain ones)
+- [X] `fractionated-morse`: aka Fractionated Morse Cipher (Morse code split into groups of three symbols, each replaced by a letter of a keyed alphabet)
+- [X] `gronsfeld`: aka Gronsfeld Cipher (variant of Vigenere Cipher with a numeric key)
+- [X] `hill`: aka Hill Cipher (blocks of letters multiplied by a key matrix modulo 26)
+- [X] `nihilist`: aka Nihilist Cipher (sums of the Polybius coordinates of the text and of a repeated key)
+- [X] `okto3`: aka OKTO3 (variant of AER-256 with a fourth operation and smaller blocks)
+- [X] `playfair`: aka Playfair Cipher
+- [X] `phillips`: aka Phillips Cipher (polyalphabetic block cipher with 8 key squares)
+- [X] `polybius`: aka Polybius Square Cipher
+- [X] `porta`: aka Porta Cipher (reciprocal variant of Vigenere Cipher with 13 alphabets)
+- [X] `railfence`: aka Rail Fence Cipher
+- [X] `rotN`: aka Caesar cipher (*N* belongs to [1,25])
+- [X] `scytaleN`: encrypts using the number of letters on the rod (*N* belongs to [1,[)
+- [X] `shiftN`: shift ordinals (*N* belongs to [1,255])
+- [X] `skip`: aka Skip Cipher (transposition reading every N-th character, looping on the text)
+- [X] `trithemius`: aka Trithemius Cipher (variant of Vigenere Cipher)
+- [X] `twosquare`: aka Two-square Cipher or Double Playfair (bigrams substituted with two keyed squares, vertically or horizontally)
+- [X] `vernam`: aka Vernam Cipher (XOR with a repeating key)
+- [X] `vic`: aka VIC Cipher
+- [X] `vigenere`: aka Vigenere Cipher
+- [X] `xorN`: XOR with a single byte (*N* belongs to [1,255])
+- [X] `zara128`: aka ZARA-128 (variant of AER-256 with additions only and smaller blocks)
+
+> :warning: Ciphers are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.
+
+#### [Common](https://python-codext.readthedocs.io/en/latest/enc/common.html)
 
 - [X] `a1z26`: keeps words whitespace-separated and uses a custom character separator
 - [X] `cases`: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
@@ -1014,83 +1088,147 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `ordinal`: dummy character ordinals conversion (converts to 3-digits groups)
 - [X] `ordinal-spaced`: variant of `ordinal` ; dummy character ordinals conversion, handling whitespace separators
 
-#### [Compression](https://python-codext.readthedocs.io/en/latest/enc/compressions)
+#### [Compression](https://python-codext.readthedocs.io/en/latest/enc/compressions.html)
 
 - [X] `gzip`: standard Gzip compression/decompression
+- [X] `huffman`: canonical Huffman coding of the bytes, with a self-describing header
 - [X] `lz77`: compresses the given data with the algorithm of Lempel and Ziv of 1977
 - [X] `lz78`: compresses the given data with the algorithm of Lempel and Ziv of 1978
 - [X] `pkzip_deflate`: standard Zip-deflate compression/decompression
 - [X] `pkzip_bzip2`: standard BZip2 compression/decompression
 - [X] `pkzip_lzma`: standard LZMA compression/decompression
+- [X] `rle`: compresses runs of identical characters with Run-Length Encoding (count before or after each character, compact, bytes or repeated-byte escape variants)
+- [X] `zstd`: Zstandard compression/decompression (relies on `compression.zstd` from Python 3.14, on `backports.zstd` before)
 
 > :warning: Compression functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.
 
-#### [Cryptography](https://python-codext.readthedocs.io/en/latest/enc/crypto)
+#### [Esoteric](https://python-codext.readthedocs.io/en/latest/enc/esoteric.html)
 
-- [X] `affine`: aka Affine Cipher
-- [X] `atbash`: aka Atbash Cipher
-- [X] `autoclave`: aka Autoclave/Autokey Cipher (variant of Vigenere Cipher)
-- [X] `bacon`: aka Baconian Cipher
-- [X] `barbie-N`: aka Barbie Typewriter (*N* belongs to [1, 4])
-- [X] `beaufort`: aka Beaufort Cipher (variant of Vigenere Cipher)
-- [X] `citrix`: aka Citrix CTX1 password encoding
-- [X] `playfair`: aka Playfair Cipher
-- [X] `phillips`: aka Phillips Cipher (polyalphabetic block cipher with 8 key squares)
-- [X] `polybius`: aka Polybius Square Cipher
-- [X] `railfence`: aka Rail Fence Cipher
-- [X] `rotN`: aka Caesar cipher (*N* belongs to [1,25])
-- [X] `scytaleN`: encrypts using the number of letters on the rod (*N* belongs to [1,[)
-- [X] `shiftN`: shift ordinals (*N* belongs to [1,255])
-- [X] `trithemius`: aka Trithemius Cipher (variant of Vigenere Cipher)
-- [X] `vic`: aka VIC Cipher
-- [X] `vigenere`: aka Vigenere Cipher
-- [X] `xorN`: XOR with a single byte (*N* belongs to [1,255])
+- [X] `befunge`: Befunge-93, two-dimensional esoteric language (encoding generates a program printing the text)
+- [X] `brainfuck`: well-known esoteric programming language (encoding generates a program printing the text)
+- [X] `church`: Church encoding in the lambda calculus (encoding generates a lambda term of the list of the numerals of the bytes)
+- [X] `cow`: esoteric language made of variations of "moo" (Brainfuck-like, with a register and integer output)
+- [X] `lolcode`: esoteric language inspired by lolcats (encoding generates a program printing the text), also with lowercase keywords
+- [X] `malbolge`: esoteric language designed to be as difficult to program in as possible (encoding generates a program printing the text)
+- [X] `ook`: Brainfuck derivative for orang-utans (`Ook.`, `Ook?` and `Ook!`), also in its short form
+- [X] `piet`: esoteric language whose programs are images looking like abstract paintings (encoding generates a PNG image of a program printing the text)
+- [X] `pikalang`: Brainfuck derivative using Pikachu's vocabulary
 
-> :warning: Crypto functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.
+#### [Frequency](https://python-codext.readthedocs.io/en/latest/enc/frequency.html)
 
-#### [Hashing](https://python-codext.readthedocs.io/en/latest/enc/hashing)
+- [X] `coquelet`: Coquelet 13 and 8 (aka Mk 1 and Mk 2), radio teleprinter systems sending each ITA-2 character as two audio tones (gives their frequencies in Hz)
+- [X] `dtmf`: Dual-Tone Multi-Frequency telephone keypad signaling (gives the frequencies of the tones in Hz, or a WAV recording with `dtmf-wav`, decoded with the Goertzel algorithm)
+- [X] `piccolo`: Piccolo I, II (aka Mk 6) and III, radio teleprinter systems sending each ITA-2 character as one or two audio tones (gives their frequencies in Hz)
 
+#### [Hashing](https://python-codext.readthedocs.io/en/latest/enc/hashing.html)
+
+- [X] `argon2`: aka Argon2 (RFC 9106) with its i, d and id variants (relies on `argon2-cffi`, e.g. with `pip install codext[argon2]`)
+- [X] `bcrypt`: aka bcrypt password hash (relies on `bcrypt` when available, e.g. with `pip install codext[bcrypt]`, pure Python otherwise)
+- [X] `bigcrypt`: aka BigCrypt (DES-based crypt variant for long passwords)
 - [X] `blake`: includes BLAKE2b and BLAKE2s (Python 3 only ; relies on `hashlib`)
+- [X] `bsd-nthash`: NT hash in the `$3$$` modular crypt format of modern BSD
+- [X] `bsdi-crypt`: aka BSDi extended DES crypt (parametrized with the number of rounds)
+- [X] `cisco-asa`: Cisco ASA password hash (parametrized with the user name)
+- [X] `cisco-pix`: Cisco PIX password hash (parametrized with the user name)
 - [X] `crypt`: Unix's crypt hash for passwords (Python 3 and Unix only ; relies on `crypt`)
-- [X] `md`: aka Message Digest ; includes MD4 and MD5 (relies on `hashlib`)
-- [X] `sha`: aka Secure Hash Algorithms ; includes SHA1, 224, 256, 384, 512 (Python2/3) but also SHA3-224, -256, -384 and -512 (Python 3 only ; relies on `hashlib`)
+- [X] `crypt16`: aka crypt16 (DES-based crypt variant with two computations)
+- [X] `ctph`: context triggered piecewise hash of the ctph.js library (as used by CyberChef)
+- [X] `fnv`: aka Fowler-Noll-Vo ; includes FNV-1 and FNV-1a in 32, 64, 128, 256, 512 and 1024 bits
+- [X] `gosthash`: aka Streebog (GOST R 34.11-2012) in 256 and 512 bits
+- [X] `hmac`: keyed-hash message authentication code with MD5, SHA-1, SHA-2, SHA-3 or BLAKE2 (relies on `hmac`)
+- [X] `keccak`: original Keccak (pre-SHA-3 padding, as used e.g. by Ethereum) in 224, 256, 384 and 512 bits
+- [X] `ldap-md5`: RFC 2307 LDAP password schemes ; `ldap-sha1`, `ldap-salted-md5` and `ldap-salted-sha1` for the SHA-1 and salted variants
+- [X] `lm`: aka LAN Manager hash, the legacy Windows password hash (with a pure Python DES)
+- [X] `md`: aka Message Digest ; includes MD2, MD4 (relies on `hashlib` when available, pure Python otherwise), MD5 (relies on `hashlib`) and MD6 (digest sizes multiple of 8, up to 512 bits)
+- [X] `mscash`: aka MS-CASH / Domain Cached Credentials v1 (parametrized with the user name) ; `mscash2` for v2 (PBKDF2)
+- [X] `mssql2000`: Microsoft SQL Server 2000 password hash ; `mssql2005` for the 2005 version
+- [X] `mysql`: MySQL password hashes ; includes the MySQL 3.23 hash and the MySQL 4.1+ native password hash
+- [X] `ntlm`: aka NT hash, the Windows password hash (MD4 of the UTF-16LE password)
+- [X] `oracle10`: legacy Oracle 10g password hash (parametrized with the user name) ; `oracle11` for the 11g version
+- [X] `phpass`: portable PHP password hash (parametrized with the iteration count ; used e.g. by WordPress)
+- [X] `ripemd160`: aka RIPEMD-160 (relies on `hashlib` when available, pure Python otherwise)
+- [X] `scrypt`: aka scrypt (RFC 7914), parameterized with its cost ln, block size r and parallelism p (relies on `hashlib`)
+- [X] `sha`: aka Secure Hash Algorithms ; includes SHA0, SHA1, 224, 256, 384, 512 (Python2/3) but also SHA3-224, -256, -384 and -512 (Python 3 only ; relies on `hashlib`)
 - [X] `shake`: aka SHAKE hashing (Python 3 only ; relies on `hashlib`)
+- [X] `snefru`: aka Snefru (Merkle's hash function) in 32 to 480 bits, with 2 to 8 passes
+- [X] `ssdeep`: ssdeep fuzzy hash (context triggered piecewise hash, same output as libfuzzy)
+- [X] `sun-md5-crypt`: aka Sun MD5 crypt (parametrized with the number of rounds)
+- [X] `whirlpool`: aka Whirlpool (relies on `hashlib` when available, pure Python otherwise)
 
 > :warning: Hash functions are of course definitely **NOT** encoding functions ; they are implemented for convenience with the `.encode(...)` API from `codecs` and useful for chaning codecs.
 
-#### [Languages](https://python-codext.readthedocs.io/en/latest/enc/languages)
+#### [Languages](https://python-codext.readthedocs.io/en/latest/enc/languages.html)
 
 - [X] `braille`: well-known braille language (Python 3 only)
+- [X] `fancy`: Unicode styled alphabets (mathematical bold, italic, script, fraktur, double-struck, ..., circled and parenthesized letters), also `fullwidth` and `smallcaps`
 - [X] `ipsum`: aka lorem ipsum
-- [X] `galactic`: aka galactic alphabet or Minecraft enchantment language (Python 3 only)
+- [X] `galactic`: aka Standard Galactic Alphabet or Minecraft enchantment language (as written by most online translators)
 - [X] `leetspeak`: based on minimalistic elite speaking rules
 - [X] `morse`: uses whitespace as a separator
 - [X] `navajo`: only handles letters (not full words from the Navajo dictionary)
 - [X] `radio`: aka NATO or radio phonetic alphabet
 - [X] `southpark`: converts letters to Kenny's language from Southpark (whitespace is also handled)
 - [X] `southpark-icase`: case insensitive variant of `southpark`
-- [X] `tap`: converts text to tap/knock code, commonly used by prisoners
+- [X] `tap`: converts text to tap/knock code, commonly used by prisoners (as written by cryptii)
 - [X] `tomtom`: similar to `morse`, using slashes and backslashes
+- [X] `upsidedown`: upside-down (flip) text, with turned Unicode characters in reverse order
 
-#### [Others](https://python-codext.readthedocs.io/en/latest/enc/others)
+#### [Obfuscation](https://python-codext.readthedocs.io/en/latest/enc/obfuscation.html)
 
+- [X] `arabica-2rs`: aka ARABICA-2RS (URI-encoded text substituted by Arabic letters, from online JavaScript tools)
+- [X] `atom128`: aka ATOM-128 (Base64 with a shuffled alphabet, from online JavaScript tools)
+- [X] `chinzo-72c`: aka CHINZO-72C (URI-encoded text substituted by Chinese characters, from online JavaScript tools)
+- [X] `cisco-type7`: aka Cisco IOS type 7 password encoding
+- [X] `citrix`: aka Citrix CTX1 password encoding
+- [X] `esab46`: aka ESAB-46 (Base64 with a shuffled alphabet, from online JavaScript tools)
+- [X] `feron74`: aka FERON-74 (Base64 with a shuffled alphabet, from online JavaScript tools)
+- [X] `gila7`: aka GILA7 (Base64 with a shuffled alphabet, from online JavaScript tools)
+- [X] `hazz15`: aka HAZZ-15 (Base64 with a shuffled alphabet, from online JavaScript tools)
+- [X] `hindia-4x`: aka HINDIA-4X (URI-encoded text substituted by Bengali and Devanagari characters, from online JavaScript tools)
+- [X] `japoo-c2s`: aka JAPOO-C2S (URI-encoded text substituted by Chinese and Japanese characters, from online JavaScript tools)
+- [X] `korex-3s`: aka KOREX-3S (URI-encoded text substituted by Korean characters, from online JavaScript tools)
+- [X] `megan35`: aka MEGAN-35 (Base64 with a shuffled alphabet, from online JavaScript tools)
+- [X] `tigo-3fx`: aka TIGO-3FX (Base64 with a shuffled alphabet, from online JavaScript tools)
+- [X] `tripo-5`: aka TRIPO-5 (Base64 with a shuffled alphabet, from online JavaScript tools)
+- [X] `zong22`: aka ZONG22 (Base64 with a shuffled alphabet, from online JavaScript tools)
+
+#### [Others](https://python-codext.readthedocs.io/en/latest/enc/others.html)
+
+- [X] `asn1`: readable dump of ASN.1 BER/DER elements (e.g. certificates and keys), encoded back to DER
+- [X] `ber`: text as an ASN.1 BER string element (decoding indefinite lengths and segmented strings)
+- [X] `binhex`: BinHex 4.0 (`.hqx`), the binary-to-text encoding of the classic Mac OS
+- [X] `der`: text as an ASN.1 DER string element (UTF8String)
 - [X] `dna`: implements the 8 rules of DNA sequences (N belongs to [1,8])
+- [X] `dvorak`: text typed with the Dvorak keyboard layout instead of QWERTY
+- [X] `kbshift`: keyboard-row shift on multiple layouts (azerty, qwerty, dvorak, ...), parameterized with the layout and shift
 - [X] `letter-indices`: encodes consonants and/or vowels with their corresponding indices
 - [X] `markdown`: unidirectional encoding from Markdown to HTML
+- [X] `ns3`: ZyXEL NDMS V2 configuration password scrambling (aka NS3)
+- [X] `soundex`: Soundex phonetic codes (decoding gives English words with the same codes)
+- [X] `telegraph`: Chinese telegraph code, with the codebooks of Mainland China and Taiwan
+- [X] `xx`: XXencode, a UUencode variant with an alphanumeric alphabet (`+`, `-`, digits and letters)
+- [X] `xy`: binary written with two symbols, `x` and `y` by default (aka X-Y)
+- [X] `yenc`: Usenet binary-to-text encoding (raw, wrapped or framed with header, trailer and CRC32)
 
-#### [Steganography](https://python-codext.readthedocs.io/en/latest/enc/stegano)
+#### [Steganography](https://python-codext.readthedocs.io/en/latest/enc/stegano.html)
 
 - [X] `hexagram`: uses Base64 and encodes the result to a charset of [I Ching hexagrams](https://en.wikipedia.org/wiki/Hexagram_%28I_Ching%29) (as implemented [here](https://github.com/qntm/hexagram-encode))
 - [X] `klopf`: aka Klopf code ; Polybius square with trivial alphabetical distribution
 - [X] `resistor`: aka resistor color codes
 - [X] `rick`: aka Rick cipher (in reference to Rick Astley's song "*Never gonna give you up*")
 - [X] `sms`: also called _T9 code_ ; uses "`-`" as a separator for encoding, "`-`" or "`_`" or whitespace for decoding
+- [X] `unicode-tags`: aka ASCII smuggling ; hides ASCII text in invisible Unicode tag characters
 - [X] `whitespace`: replaces bits with whitespaces and tabs
 - [X] `whitespace_after_before`: variant of `whitespace` ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "`whitespace+2*after-3*before`")
+- [X] `zero-width`: hides text in invisible zero-width characters (binary, ternary and quinary variants, compatible with zwsp-steg)
 
-#### [Web](https://python-codext.readthedocs.io/en/latest/enc/web)
+#### [Web](https://python-codext.readthedocs.io/en/latest/enc/web.html)
 
+- [X] `aaencode`: JavaScript obfuscation with Japanese-style emoticons (encoding generates a program running the code)
 - [X] `html`: implements entities according to [this reference](https://dev.w3.org/html5/html-author/charref)
+- [X] `jjencode`: JavaScript obfuscation with only symbols (encoding generates a program running the code)
+- [X] `jsfuck`: JavaScript with only six characters (`[]()!+`) ; encoding generates an expression giving the text, or a program running the code with `jsfuck-eval`
 - [X] `url`: aka URL encoding
 
 
+<p align="center"><a href="#top"><img src="https://img.shields.io/badge/Back%20to%20top--lightgrey?style=social" alt="Back to top" height="20"/></a></p>