codext 1.16.5__tar.gz → 2.0.0__tar.gz

codext-2.0.0/.github/dependabot.yml

@@ -0,0 +1,15 @@
+version: 2
+updates:
+  - package-ecosystem: github-actions
+    directory: /
+    schedule:
+      interval: monthly
+    groups:
+      actions:
+        patterns: ["*"]
+  - package-ecosystem: pip
+    directory: /
+    schedule:
+      interval: monthly
+    # dependencies are minimum versions (>=) ; only open security updates, not routine upgrades
+    open-pull-requests-limit: 0

codext-2.0.0/.github/workflows/python-package.yml

@@ -0,0 +1,141 @@
+# This workflow will install Python dependencies, run tests and lint with a variety of Python versions
+# For more information see: https://docs.github.com/en/actions/automating-builds-and-tests/building-and-testing-python
+
+name: build
+
+on:
+  push:
+    branches: [ "main" ]
+  pull_request:
+    branches: [ "main" ]
+
+permissions:
+  contents: read
+
+jobs:
+  prepare:
+    runs-on: ubuntu-latest
+    outputs:
+      package: ${{ steps.pkg.outputs.package }}
+      pypi_url: ${{ steps.pkg.outputs.pypi_url }}
+    steps:
+      - name: Compute package name from the repository's
+        id: pkg
+        run: |
+          name="${GITHUB_REPOSITORY##*/}"
+          echo "package=${name#python-}" >> $GITHUB_OUTPUT
+          echo "pypi_url=https://pypi.org/p/${name#python-}" >> $GITHUB_OUTPUT
+  build:
+    needs: prepare
+    runs-on: ${{ matrix.os }}
+    strategy:
+      fail-fast: false
+      matrix:
+        os: [ubuntu-latest]
+        python-version: ["3.10", "3.11", "3.12", "3.13"]
+    env:
+      package: ${{ needs.prepare.outputs.package }}
+      cov_python_version: "3.13"
+    steps:
+    - uses: actions/checkout@v7
+    - name: Set up Python ${{ matrix.python-version }}
+      uses: actions/setup-python@v7
+      with:
+        python-version: ${{ matrix.python-version }}
+    - name: Install ${{ env.package }}
+      run: |
+        python -m pip install --upgrade pip
+        python -m pip install pytest pytest-cov
+        pip install -r requirements.txt
+        pip install "tinyscript>=1.31"
+        pip install .
+    - name: Test ${{ env.package }} with pytest
+      run: |
+        pytest --cov=$package --cov-report=xml
+    - name: Upload coverage report
+      if: matrix.python-version == env.cov_python_version
+      uses: actions/upload-artifact@v7
+      with:
+        name: coverage-report
+        path: coverage.xml
+  coverage:
+    # only publish the badge for commits on main (not for pull requests)
+    if: github.event_name == 'push' && github.ref == 'refs/heads/main'
+    needs: build
+    permissions:
+      contents: write
+    runs-on: ubuntu-latest
+    env:
+      cov_badge_path: docs/coverage.svg
+    steps:
+    - uses: actions/checkout@v7
+    - name: Set up Python
+      uses: actions/setup-python@v7
+      with:
+        python-version: "3.13"
+    - name: Download coverage report
+      uses: actions/download-artifact@v8
+      with:
+        name: coverage-report
+    - name: Make coverage badge
+      run: |
+        pip install genbadge[coverage]
+        genbadge coverage -i coverage.xml -o $cov_badge_path
+    - name: Push coverage badge
+      run: |
+        # keep the badge alone on an orphan branch so that main is never modified by the workflow
+        git config --local user.email "github-actions[bot]@users.noreply.github.com"
+        git config --local user.name "github-actions[bot]"
+        if git fetch --depth=1 origin coverage-badge 2>/dev/null && \
+           git show FETCH_HEAD:$cov_badge_path | cmp -s - $cov_badge_path; then
+          echo "Coverage badge unchanged"
+          exit 0
+        fi
+        git checkout --orphan coverage-badge
+        git rm -rqf --cached .
+        git add $cov_badge_path
+        git commit -m "Update coverage badge"
+        git push origin coverage-badge --force
+  deploy:
+    # only release from main, never from pull requests
+    if: github.event_name == 'push' && github.ref == 'refs/heads/main'
+    environment:
+      name: pypi
+      url: ${{ needs.prepare.outputs.pypi_url }}
+    permissions:
+      contents: read
+      id-token: write  # for PyPI trusted publishing (OIDC)
+    runs-on: ubuntu-latest
+    needs: [prepare, build]
+    env:
+      package: ${{ needs.prepare.outputs.package }}
+    steps:
+    - uses: actions/checkout@v7
+    - name: Check whether the version is already on PyPI
+      # comparing with PyPI (not with the previous commit) also releases a version whose push did not trigger a deploy
+      id: version
+      run: |
+        version=$(tr -d '[:space:]' < src/$package/VERSION.txt)
+        status=$(curl -s -o /dev/null -w '%{http_code}' --retry 3 "https://pypi.org/pypi/$package/$version/json")
+        case "$status" in
+          200) echo "Version $version is already on PyPI" ; echo "new=false" >> "$GITHUB_OUTPUT" ;;
+          404) echo "Version $version is not on PyPI yet" ; echo "new=true" >> "$GITHUB_OUTPUT" ;;
+          *)   echo "::error::Unexpected HTTP status $status from PyPI" ; exit 1 ;;
+        esac
+    - if: steps.version.outputs.new == 'true'
+      name: Set up Python
+      uses: actions/setup-python@v7
+      with:
+        python-version: "3.13"
+    - if: steps.version.outputs.new == 'true'
+      name: Cleanup README
+      run: |
+        sed -ri 's/^(##*)\s*:.*:\s*/\1 /g' README.md
+        awk '{if (match($0,"## Supporters")) exit; print}' README.md > README
+        mv -f README README.md
+    - if: steps.version.outputs.new == 'true'
+      name: Build ${{ needs.prepare.outputs.package }} package
+      run: python -m pip install --upgrade build && python -m build
+    - if: steps.version.outputs.new == 'true'
+      name: Publish to PyPI
+      uses: pypa/gh-action-pypi-publish@release/v1

codext-2.0.0/.github/workflows/security.yml

@@ -0,0 +1,31 @@
+# This workflow audits the project's dependencies for known vulnerabilities
+# It is separate from python-package.yml so that a new advisory never blocks a release
+
+name: security
+
+on:
+  push:
+    branches: [ "main" ]
+  pull_request:
+    branches: [ "main" ]
+  schedule:
+    - cron: "0 6 * * 1"  # weekly, catches new advisories between pushes
+  workflow_dispatch:
+
+permissions:
+  contents: read
+
+jobs:
+  pip-audit:
+    runs-on: ubuntu-latest
+    steps:
+    - uses: actions/checkout@v7
+    - name: Set up Python
+      uses: actions/setup-python@v7
+      with:
+        python-version: "3.13"
+    - name: Install pip-audit
+      run: python -m pip install --upgrade pip pip-audit
+    - name: Audit dependencies
+      # audit the project path (not the environment) so that the runner's own packages are not reported
+      run: pip-audit .

codext-1.16.5/.readthedocs.yml → codext-2.0.0/.readthedocs.yaml

@@ -1,9 +1,9 @@
 version: 2
 
 build:
-  os: "ubuntu-22.04"
+  os: ubuntu-24.04
   tools:
-    python: "3.11"
+    python: "3.13"
 
 mkdocs:
   configuration: docs/mkdocs.yml

{codext-1.16.5 → codext-2.0.0}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: codext
-Version: 1.16.5
+Version: 2.0.0
 Summary: Native codecs extension
 Author-email: Alexandre D'Hondt <alexandre.dhondt@gmail.com>
 License:                     GNU GENERAL PUBLIC LICENSE
@@ -689,7 +689,7 @@ Classifier: Intended Audience :: Developers
 Classifier: License :: OSI Approved :: GNU General Public License v3 or later (GPLv3+)
 Classifier: Programming Language :: Python :: 3
 Classifier: Topic :: Software Development :: Libraries :: Python Modules
-Requires-Python: <4,>=3.8
+Requires-Python: <4,>=3.10
 Description-Content-Type: text/markdown
 License-File: LICENSE
 Requires-Dist: legacycrypt; python_version >= "3.13"
@@ -701,15 +701,15 @@ Dynamic: license-file
 <h3 align="center">Encode/decode anything.</h3>
 
 [![PyPi](https://img.shields.io/pypi/v/codext.svg)](https://pypi.python.org/pypi/codext/)
+[![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
 [![Read The Docs](https://readthedocs.org/projects/python-codext/badge/?version=latest)](https://python-codext.readthedocs.io/en/latest/?badge=latest)
 [![Build Status](https://github.com/dhondta/python-codext/actions/workflows/python-package.yml/badge.svg)](https://github.com/dhondta/python-codext/actions/workflows/python-package.yml)
+[![Security](https://github.com/dhondta/python-codext/actions/workflows/security.yml/badge.svg)](https://github.com/dhondta/python-codext/actions/workflows/security.yml)
 [![Coverage Status](https://raw.githubusercontent.com/dhondta/python-codext/coverage-badge/docs/coverage.svg)](#)
-[![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
-[![Known Vulnerabilities](https://snyk.io/test/github/dhondta/python-codext/badge.svg?targetFile=requirements.txt)](https://snyk.io/test/github/dhondta/python-codext?targetFile=requirements.txt)
 [![DOI](https://zenodo.org/badge/236679865.svg)](https://zenodo.org/badge/latestdoi/236679865)
 [![License](https://img.shields.io/pypi/l/codext.svg)](https://pypi.python.org/pypi/codext/)
 
-[**CodExt**](https://github.com/dhondta/python-codext) is a (Python2-3 compatible) library that extends the native [`codecs`](https://docs.python.org/3/library/codecs) library (namely for adding new custom encodings and character mappings) and provides **120+ new codecs**, hence its name combining *CODecs EXTension*. It also features a **guess mode** for decoding multiple layers of encoding and **CLI tools** for convenience.
+[**CodExt**](https://github.com/dhondta/python-codext) is a library (Python 3.10 or later) that extends the native [`codecs`](https://docs.python.org/3/library/codecs) library (namely for adding new custom encodings and character mappings) and provides **120+ new codecs**, hence its name combining *CODecs EXTension*. It also features a **guess mode** for decoding multiple layers of encoding and **CLI tools** for convenience.
 
 ```sh
 $ pip install codext
@@ -717,7 +717,7 @@ $ pip install codext
 
 Want to contribute a new codec ?    |     Want to contribute a new macro ?
 :----------------------------------:|:------------------------------------:
-Check the [documentation](https://python-codext.readthedocs.io/en/latest/howto) first<br>Then [PR](https://github.com/dhondta/python-codext/pulls) your new codec | [PR](https://github.com/dhondta/python-codext/pulls) your updated version of [`macros.json`](https://github.com/dhondta/python-codext/blob/main/codext/macros.json)
+Check the [documentation](https://python-codext.readthedocs.io/en/latest/howto.html) first<br>Then [PR](https://github.com/dhondta/python-codext/pulls) your new codec | [PR](https://github.com/dhondta/python-codext/pulls) your updated version of [`macros.json`](https://github.com/dhondta/python-codext/blob/main/src/codext/macros.json)
 
 ## Demonstrations
 
@@ -957,7 +957,7 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 
 ## List of codecs
 
-#### [BaseXX](https://python-codext.readthedocs.io/en/latest/enc/base)
+#### [BaseXX](https://python-codext.readthedocs.io/en/latest/enc/base.html)
 
 - [X] `base1`: useless, but for the sake of completeness
 - [X] `base2`: simple conversion to binary (with a variant with a reversed alphabet)
@@ -970,6 +970,7 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 - [X] `base26`: conversion to alphabet letters
 - [X] `base32`: classical conversion according to the RFC4648 with all its variants ([zbase32](https://philzimmermann.com/docs/human-oriented-base-32-encoding.txt), extended hexadecimal, [geohash](https://en.wikipedia.org/wiki/Geohash), [Crockford](https://www.crockford.com/base32))
 - [X] `base36`: [Base36](https://en.wikipedia.org/wiki/Base36) conversion to letters and digits (with a variant inverting both groups)
+- [X] `base38`: [Base38](https://github.com/project-chip/connectedhomeip/blob/master/src/setup_payload/Base38Encode.cpp) encoding of the Matter setup QR codes (chunks of 3 bytes)
 - [X] `base45`: [Base45](https://datatracker.ietf.org/doc/html/draft-faltstrom-base45-04.txt) DRAFT algorithm (with a variant inverting letters and digits)
 - [X] `base58`: multiple versions of [Base58](https://en.bitcoinwiki.org/wiki/Base58) (bitcoin, flickr, ripple)
 - [X] `base62`: [Base62](https://en.wikipedia.org/wiki/Base62) conversion to lower- and uppercase letters and digits (with a variant with letters and digits inverted)
@@ -980,11 +981,17 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 - [X] `base91`: [Base91](http://base91.sourceforge.net) custom conversion
 - [X] `base100` (or *emoji*): [Base100](https://github.com/AdamNiederer/base100) custom conversion
 - [X] `base122`: [Base100](http://blog.kevinalbs.com/base122) custom conversion
-- [X] `base-genericN`: see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base) ; supports any possible base
+- [X] `base1024` (or *ecoji*): [Ecoji](https://github.com/keith-turner/ecoji) custom conversion (10 bits per emoji, versions 1 and 2)
+- [X] `base2048`: [Base2048](https://github.com/qntm/base2048) custom conversion (11 bits per character, optimised for Twitter)
+- [X] `base32768`: [Base32768](https://github.com/qntm/base32768) custom conversion (15 bits per character, optimised for UTF-16)
+- [X] `base65536`: [Base65536](https://github.com/qntm/base65536) custom conversion (16 bits per character, optimised for UTF-32)
+- [X] `bech32`: [Bech32](https://github.com/bitcoin/bips/blob/master/bip-0173.mediawiki) encoding with a human-readable part ; `bech32m` for its [Bech32m](https://github.com/bitcoin/bips/blob/master/bip-0350.mediawiki) variant
+- [X] `leb128` (or *varint*): [LEB128](https://en.wikipedia.org/wiki/LEB128) encoding of lists of integers ; `sleb128` for its signed variant
+- [X] `base-genericN`: see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base.html) ; supports any possible base
 
 This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `base85` codec.
 
-#### [Binary](https://python-codext.readthedocs.io/en/latest/enc/binary)
+#### [Binary](https://python-codext.readthedocs.io/en/latest/enc/binary.html)
 
 - [X] `baudot`: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
 - [X] `baudot-spaced`: variant of `baudot` ; groups of 5 bits are whitespace-separated
@@ -992,19 +999,22 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `bcd`: _Binary Coded Decimal_, encodes characters from their (zero-left-padded) ordinals
 - [X] `bcd-extended0`: variant of `bcd` ; encodes characters from their (zero-left-padded) ordinals using prefix bits `0000`
 - [X] `bcd-extended1`: variant of `bcd` ; encodes characters from their (zero-left-padded) ordinals using prefix bits `1111`
+- [X] `chuck-norris`: Chuck Norris unary code (runs of the 7-bit ASCII bits written with blocks of zeros)
+- [X] `elias-gamma`, `elias-delta`: Elias universal codes, encoding characters from their ordinals (or lists of integers with `-integers`)
 - [X] `excess3`: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
+- [X] `fibonacci`: Fibonacci universal code, encoding characters from their ordinals (or lists of integers with `-integers`)
 - [X] `gray`: aka reflected binary code
 - [X] `manchester`: XORes each bit of the input with `01`
 - [X] `manchester-inverted`: variant of `manchester` ; XORes each bit of the input with `10`
 - [X] `rotateN`: rotates characters by the specified number of bits (*N* belongs to [1, 7] ; Python 3 only)
 
-#### [Checksums](https://python-codext.readthedocs.io/en/latest/enc/checksums)
+#### [Checksums](https://python-codext.readthedocs.io/en/latest/enc/hashing.html#checksums)
 
 - [X] `adler`: Adler32 algorithm (relies on `zlib`)
 - [X] `crc`: CRC of lengths 8, 10-17, 21, 24, 30-32, 40, 64, 82 with a variety of polynoms
 - [X] `luhn`: Luhn mod N algorithm
 
-#### [Common](https://python-codext.readthedocs.io/en/latest/enc/common)
+#### [Common](https://python-codext.readthedocs.io/en/latest/enc/common.html)
 
 - [X] `a1z26`: keeps words whitespace-separated and uses a custom character separator
 - [X] `cases`: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
@@ -1014,7 +1024,7 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `ordinal`: dummy character ordinals conversion (converts to 3-digits groups)
 - [X] `ordinal-spaced`: variant of `ordinal` ; dummy character ordinals conversion, handling whitespace separators
 
-#### [Compression](https://python-codext.readthedocs.io/en/latest/enc/compressions)
+#### [Compression](https://python-codext.readthedocs.io/en/latest/enc/compressions.html)
 
 - [X] `gzip`: standard Gzip compression/decompression
 - [X] `lz77`: compresses the given data with the algorithm of Lempel and Ziv of 1977
@@ -1022,25 +1032,36 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `pkzip_deflate`: standard Zip-deflate compression/decompression
 - [X] `pkzip_bzip2`: standard BZip2 compression/decompression
 - [X] `pkzip_lzma`: standard LZMA compression/decompression
+- [X] `rle`: compresses runs of identical characters with Run-Length Encoding (count before or after each character, compact, bytes or repeated-byte escape variants)
 
 > :warning: Compression functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.
 
-#### [Cryptography](https://python-codext.readthedocs.io/en/latest/enc/crypto)
+#### [Cryptography](https://python-codext.readthedocs.io/en/latest/enc/crypto.html)
 
+- [X] `adfgx`: aka ADFGX Cipher (Polybius square and columnar transposition) ; `adfgvx` for its 6x6 variant
 - [X] `affine`: aka Affine Cipher
 - [X] `atbash`: aka Atbash Cipher
 - [X] `autoclave`: aka Autoclave/Autokey Cipher (variant of Vigenere Cipher)
 - [X] `bacon`: aka Baconian Cipher
 - [X] `barbie-N`: aka Barbie Typewriter (*N* belongs to [1, 4])
+- [X] `bazeries`: aka Bazeries Cipher (two Polybius grids and a transposition keyed by a number)
 - [X] `beaufort`: aka Beaufort Cipher (variant of Vigenere Cipher)
+- [X] `bifid`: aka Bifid Cipher (Delastelle's fractionation with a 5x5 Polybius square) ; `trifid` for its 3x3x3 cube variant
+- [X] `chaocipher`: aka Chaocipher (two alphabets permuted after each letter)
 - [X] `citrix`: aka Citrix CTX1 password encoding
+- [X] `columnar`: aka Columnar Transposition Cipher (keyword-ordered columns ; a second keyword gives the double transposition)
+- [X] `gronsfeld`: aka Gronsfeld Cipher (variant of Vigenere Cipher with a numeric key)
+- [X] `hill`: aka Hill Cipher (blocks of letters multiplied by a key matrix modulo 26)
+- [X] `nihilist`: aka Nihilist Cipher (sums of the Polybius coordinates of the text and of a repeated key)
 - [X] `playfair`: aka Playfair Cipher
 - [X] `phillips`: aka Phillips Cipher (polyalphabetic block cipher with 8 key squares)
 - [X] `polybius`: aka Polybius Square Cipher
+- [X] `porta`: aka Porta Cipher (reciprocal variant of Vigenere Cipher with 13 alphabets)
 - [X] `railfence`: aka Rail Fence Cipher
 - [X] `rotN`: aka Caesar cipher (*N* belongs to [1,25])
 - [X] `scytaleN`: encrypts using the number of letters on the rod (*N* belongs to [1,[)
 - [X] `shiftN`: shift ordinals (*N* belongs to [1,255])
+- [X] `skip`: aka Skip Cipher (transposition reading every N-th character, looping on the text)
 - [X] `trithemius`: aka Trithemius Cipher (variant of Vigenere Cipher)
 - [X] `vic`: aka VIC Cipher
 - [X] `vigenere`: aka Vigenere Cipher
@@ -1048,7 +1069,7 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 
 > :warning: Crypto functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.
 
-#### [Hashing](https://python-codext.readthedocs.io/en/latest/enc/hashing)
+#### [Hashing](https://python-codext.readthedocs.io/en/latest/enc/hashing.html)
 
 - [X] `blake`: includes BLAKE2b and BLAKE2s (Python 3 only ; relies on `hashlib`)
 - [X] `crypt`: Unix's crypt hash for passwords (Python 3 and Unix only ; relies on `crypt`)
@@ -1058,7 +1079,7 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 
 > :warning: Hash functions are of course definitely **NOT** encoding functions ; they are implemented for convenience with the `.encode(...)` API from `codecs` and useful for chaning codecs.
 
-#### [Languages](https://python-codext.readthedocs.io/en/latest/enc/languages)
+#### [Languages](https://python-codext.readthedocs.io/en/latest/enc/languages.html)
 
 - [X] `braille`: well-known braille language (Python 3 only)
 - [X] `ipsum`: aka lorem ipsum
@@ -1072,25 +1093,31 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `tap`: converts text to tap/knock code, commonly used by prisoners
 - [X] `tomtom`: similar to `morse`, using slashes and backslashes
 
-#### [Others](https://python-codext.readthedocs.io/en/latest/enc/others)
+#### [Others](https://python-codext.readthedocs.io/en/latest/enc/others.html)
 
+- [X] `binhex`: BinHex 4.0 (`.hqx`), the binary-to-text encoding of the classic Mac OS
 - [X] `dna`: implements the 8 rules of DNA sequences (N belongs to [1,8])
 - [X] `letter-indices`: encodes consonants and/or vowels with their corresponding indices
 - [X] `markdown`: unidirectional encoding from Markdown to HTML
+- [X] `xx`: XXencode, a UUencode variant with an alphanumeric alphabet (`+`, `-`, digits and letters)
+- [X] `yenc`: Usenet binary-to-text encoding (raw, wrapped or framed with header, trailer and CRC32)
 
-#### [Steganography](https://python-codext.readthedocs.io/en/latest/enc/stegano)
+#### [Steganography](https://python-codext.readthedocs.io/en/latest/enc/stegano.html)
 
 - [X] `hexagram`: uses Base64 and encodes the result to a charset of [I Ching hexagrams](https://en.wikipedia.org/wiki/Hexagram_%28I_Ching%29) (as implemented [here](https://github.com/qntm/hexagram-encode))
 - [X] `klopf`: aka Klopf code ; Polybius square with trivial alphabetical distribution
 - [X] `resistor`: aka resistor color codes
 - [X] `rick`: aka Rick cipher (in reference to Rick Astley's song "*Never gonna give you up*")
 - [X] `sms`: also called _T9 code_ ; uses "`-`" as a separator for encoding, "`-`" or "`_`" or whitespace for decoding
+- [X] `unicode-tags`: aka ASCII smuggling ; hides ASCII text in invisible Unicode tag characters
 - [X] `whitespace`: replaces bits with whitespaces and tabs
 - [X] `whitespace_after_before`: variant of `whitespace` ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "`whitespace+2*after-3*before`")
+- [X] `zero-width`: hides text in invisible zero-width characters (binary, ternary and quinary variants, compatible with zwsp-steg)
 
-#### [Web](https://python-codext.readthedocs.io/en/latest/enc/web)
+#### [Web](https://python-codext.readthedocs.io/en/latest/enc/web.html)
 
 - [X] `html`: implements entities according to [this reference](https://dev.w3.org/html5/html-author/charref)
 - [X] `url`: aka URL encoding
 
 
+<p align="center"><a href="#top"><img src="https://img.shields.io/badge/Back%20to%20top--lightgrey?style=social" alt="Back to top" height="20"/></a></p>

{codext-1.16.5 → codext-2.0.0}/README.md

@@ -3,15 +3,15 @@
 <h3 align="center">Encode/decode anything.</h3>
 
 [![PyPi](https://img.shields.io/pypi/v/codext.svg)](https://pypi.python.org/pypi/codext/)
+[![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
 [![Read The Docs](https://readthedocs.org/projects/python-codext/badge/?version=latest)](https://python-codext.readthedocs.io/en/latest/?badge=latest)
 [![Build Status](https://github.com/dhondta/python-codext/actions/workflows/python-package.yml/badge.svg)](https://github.com/dhondta/python-codext/actions/workflows/python-package.yml)
+[![Security](https://github.com/dhondta/python-codext/actions/workflows/security.yml/badge.svg)](https://github.com/dhondta/python-codext/actions/workflows/security.yml)
 [![Coverage Status](https://raw.githubusercontent.com/dhondta/python-codext/coverage-badge/docs/coverage.svg)](#)
-[![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
-[![Known Vulnerabilities](https://snyk.io/test/github/dhondta/python-codext/badge.svg?targetFile=requirements.txt)](https://snyk.io/test/github/dhondta/python-codext?targetFile=requirements.txt)
 [![DOI](https://zenodo.org/badge/236679865.svg)](https://zenodo.org/badge/latestdoi/236679865)
 [![License](https://img.shields.io/pypi/l/codext.svg)](https://pypi.python.org/pypi/codext/)
 
-[**CodExt**](https://github.com/dhondta/python-codext) is a (Python2-3 compatible) library that extends the native [`codecs`](https://docs.python.org/3/library/codecs) library (namely for adding new custom encodings and character mappings) and provides **120+ new codecs**, hence its name combining *CODecs EXTension*. It also features a **guess mode** for decoding multiple layers of encoding and **CLI tools** for convenience.
+[**CodExt**](https://github.com/dhondta/python-codext) is a library (Python 3.10 or later) that extends the native [`codecs`](https://docs.python.org/3/library/codecs) library (namely for adding new custom encodings and character mappings) and provides **120+ new codecs**, hence its name combining *CODecs EXTension*. It also features a **guess mode** for decoding multiple layers of encoding and **CLI tools** for convenience.
 
 ```sh
 $ pip install codext
@@ -19,7 +19,7 @@ $ pip install codext
 
 Want to contribute a new codec ?    |     Want to contribute a new macro ?
 :----------------------------------:|:------------------------------------:
-Check the [documentation](https://python-codext.readthedocs.io/en/latest/howto) first<br>Then [PR](https://github.com/dhondta/python-codext/pulls) your new codec | [PR](https://github.com/dhondta/python-codext/pulls) your updated version of [`macros.json`](https://github.com/dhondta/python-codext/blob/main/codext/macros.json)
+Check the [documentation](https://python-codext.readthedocs.io/en/latest/howto.html) first<br>Then [PR](https://github.com/dhondta/python-codext/pulls) your new codec | [PR](https://github.com/dhondta/python-codext/pulls) your updated version of [`macros.json`](https://github.com/dhondta/python-codext/blob/main/src/codext/macros.json)
 
 ## Demonstrations
 
@@ -259,7 +259,7 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 
 ## List of codecs
 
-#### [BaseXX](https://python-codext.readthedocs.io/en/latest/enc/base)
+#### [BaseXX](https://python-codext.readthedocs.io/en/latest/enc/base.html)
 
 - [X] `base1`: useless, but for the sake of completeness
 - [X] `base2`: simple conversion to binary (with a variant with a reversed alphabet)
@@ -272,6 +272,7 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 - [X] `base26`: conversion to alphabet letters
 - [X] `base32`: classical conversion according to the RFC4648 with all its variants ([zbase32](https://philzimmermann.com/docs/human-oriented-base-32-encoding.txt), extended hexadecimal, [geohash](https://en.wikipedia.org/wiki/Geohash), [Crockford](https://www.crockford.com/base32))
 - [X] `base36`: [Base36](https://en.wikipedia.org/wiki/Base36) conversion to letters and digits (with a variant inverting both groups)
+- [X] `base38`: [Base38](https://github.com/project-chip/connectedhomeip/blob/master/src/setup_payload/Base38Encode.cpp) encoding of the Matter setup QR codes (chunks of 3 bytes)
 - [X] `base45`: [Base45](https://datatracker.ietf.org/doc/html/draft-faltstrom-base45-04.txt) DRAFT algorithm (with a variant inverting letters and digits)
 - [X] `base58`: multiple versions of [Base58](https://en.bitcoinwiki.org/wiki/Base58) (bitcoin, flickr, ripple)
 - [X] `base62`: [Base62](https://en.wikipedia.org/wiki/Base62) conversion to lower- and uppercase letters and digits (with a variant with letters and digits inverted)
@@ -282,11 +283,17 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 - [X] `base91`: [Base91](http://base91.sourceforge.net) custom conversion
 - [X] `base100` (or *emoji*): [Base100](https://github.com/AdamNiederer/base100) custom conversion
 - [X] `base122`: [Base100](http://blog.kevinalbs.com/base122) custom conversion
-- [X] `base-genericN`: see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base) ; supports any possible base
+- [X] `base1024` (or *ecoji*): [Ecoji](https://github.com/keith-turner/ecoji) custom conversion (10 bits per emoji, versions 1 and 2)
+- [X] `base2048`: [Base2048](https://github.com/qntm/base2048) custom conversion (11 bits per character, optimised for Twitter)
+- [X] `base32768`: [Base32768](https://github.com/qntm/base32768) custom conversion (15 bits per character, optimised for UTF-16)
+- [X] `base65536`: [Base65536](https://github.com/qntm/base65536) custom conversion (16 bits per character, optimised for UTF-32)
+- [X] `bech32`: [Bech32](https://github.com/bitcoin/bips/blob/master/bip-0173.mediawiki) encoding with a human-readable part ; `bech32m` for its [Bech32m](https://github.com/bitcoin/bips/blob/master/bip-0350.mediawiki) variant
+- [X] `leb128` (or *varint*): [LEB128](https://en.wikipedia.org/wiki/LEB128) encoding of lists of integers ; `sleb128` for its signed variant
+- [X] `base-genericN`: see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base.html) ; supports any possible base
 
 This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `base85` codec.
 
-#### [Binary](https://python-codext.readthedocs.io/en/latest/enc/binary)
+#### [Binary](https://python-codext.readthedocs.io/en/latest/enc/binary.html)
 
 - [X] `baudot`: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
 - [X] `baudot-spaced`: variant of `baudot` ; groups of 5 bits are whitespace-separated
@@ -294,19 +301,22 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `bcd`: _Binary Coded Decimal_, encodes characters from their (zero-left-padded) ordinals
 - [X] `bcd-extended0`: variant of `bcd` ; encodes characters from their (zero-left-padded) ordinals using prefix bits `0000`
 - [X] `bcd-extended1`: variant of `bcd` ; encodes characters from their (zero-left-padded) ordinals using prefix bits `1111`
+- [X] `chuck-norris`: Chuck Norris unary code (runs of the 7-bit ASCII bits written with blocks of zeros)
+- [X] `elias-gamma`, `elias-delta`: Elias universal codes, encoding characters from their ordinals (or lists of integers with `-integers`)
 - [X] `excess3`: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
+- [X] `fibonacci`: Fibonacci universal code, encoding characters from their ordinals (or lists of integers with `-integers`)
 - [X] `gray`: aka reflected binary code
 - [X] `manchester`: XORes each bit of the input with `01`
 - [X] `manchester-inverted`: variant of `manchester` ; XORes each bit of the input with `10`
 - [X] `rotateN`: rotates characters by the specified number of bits (*N* belongs to [1, 7] ; Python 3 only)
 
-#### [Checksums](https://python-codext.readthedocs.io/en/latest/enc/checksums)
+#### [Checksums](https://python-codext.readthedocs.io/en/latest/enc/hashing.html#checksums)
 
 - [X] `adler`: Adler32 algorithm (relies on `zlib`)
 - [X] `crc`: CRC of lengths 8, 10-17, 21, 24, 30-32, 40, 64, 82 with a variety of polynoms
 - [X] `luhn`: Luhn mod N algorithm
 
-#### [Common](https://python-codext.readthedocs.io/en/latest/enc/common)
+#### [Common](https://python-codext.readthedocs.io/en/latest/enc/common.html)
 
 - [X] `a1z26`: keeps words whitespace-separated and uses a custom character separator
 - [X] `cases`: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
@@ -316,7 +326,7 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `ordinal`: dummy character ordinals conversion (converts to 3-digits groups)
 - [X] `ordinal-spaced`: variant of `ordinal` ; dummy character ordinals conversion, handling whitespace separators
 
-#### [Compression](https://python-codext.readthedocs.io/en/latest/enc/compressions)
+#### [Compression](https://python-codext.readthedocs.io/en/latest/enc/compressions.html)
 
 - [X] `gzip`: standard Gzip compression/decompression
 - [X] `lz77`: compresses the given data with the algorithm of Lempel and Ziv of 1977
@@ -324,25 +334,36 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `pkzip_deflate`: standard Zip-deflate compression/decompression
 - [X] `pkzip_bzip2`: standard BZip2 compression/decompression
 - [X] `pkzip_lzma`: standard LZMA compression/decompression
+- [X] `rle`: compresses runs of identical characters with Run-Length Encoding (count before or after each character, compact, bytes or repeated-byte escape variants)
 
 > :warning: Compression functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.
 
-#### [Cryptography](https://python-codext.readthedocs.io/en/latest/enc/crypto)
+#### [Cryptography](https://python-codext.readthedocs.io/en/latest/enc/crypto.html)
 
+- [X] `adfgx`: aka ADFGX Cipher (Polybius square and columnar transposition) ; `adfgvx` for its 6x6 variant
 - [X] `affine`: aka Affine Cipher
 - [X] `atbash`: aka Atbash Cipher
 - [X] `autoclave`: aka Autoclave/Autokey Cipher (variant of Vigenere Cipher)
 - [X] `bacon`: aka Baconian Cipher
 - [X] `barbie-N`: aka Barbie Typewriter (*N* belongs to [1, 4])
+- [X] `bazeries`: aka Bazeries Cipher (two Polybius grids and a transposition keyed by a number)
 - [X] `beaufort`: aka Beaufort Cipher (variant of Vigenere Cipher)
+- [X] `bifid`: aka Bifid Cipher (Delastelle's fractionation with a 5x5 Polybius square) ; `trifid` for its 3x3x3 cube variant
+- [X] `chaocipher`: aka Chaocipher (two alphabets permuted after each letter)
 - [X] `citrix`: aka Citrix CTX1 password encoding
+- [X] `columnar`: aka Columnar Transposition Cipher (keyword-ordered columns ; a second keyword gives the double transposition)
+- [X] `gronsfeld`: aka Gronsfeld Cipher (variant of Vigenere Cipher with a numeric key)
+- [X] `hill`: aka Hill Cipher (blocks of letters multiplied by a key matrix modulo 26)
+- [X] `nihilist`: aka Nihilist Cipher (sums of the Polybius coordinates of the text and of a repeated key)
 - [X] `playfair`: aka Playfair Cipher
 - [X] `phillips`: aka Phillips Cipher (polyalphabetic block cipher with 8 key squares)
 - [X] `polybius`: aka Polybius Square Cipher
+- [X] `porta`: aka Porta Cipher (reciprocal variant of Vigenere Cipher with 13 alphabets)
 - [X] `railfence`: aka Rail Fence Cipher
 - [X] `rotN`: aka Caesar cipher (*N* belongs to [1,25])
 - [X] `scytaleN`: encrypts using the number of letters on the rod (*N* belongs to [1,[)
 - [X] `shiftN`: shift ordinals (*N* belongs to [1,255])
+- [X] `skip`: aka Skip Cipher (transposition reading every N-th character, looping on the text)
 - [X] `trithemius`: aka Trithemius Cipher (variant of Vigenere Cipher)
 - [X] `vic`: aka VIC Cipher
 - [X] `vigenere`: aka Vigenere Cipher
@@ -350,7 +371,7 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 
 > :warning: Crypto functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.
 
-#### [Hashing](https://python-codext.readthedocs.io/en/latest/enc/hashing)
+#### [Hashing](https://python-codext.readthedocs.io/en/latest/enc/hashing.html)
 
 - [X] `blake`: includes BLAKE2b and BLAKE2s (Python 3 only ; relies on `hashlib`)
 - [X] `crypt`: Unix's crypt hash for passwords (Python 3 and Unix only ; relies on `crypt`)
@@ -360,7 +381,7 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 
 > :warning: Hash functions are of course definitely **NOT** encoding functions ; they are implemented for convenience with the `.encode(...)` API from `codecs` and useful for chaning codecs.
 
-#### [Languages](https://python-codext.readthedocs.io/en/latest/enc/languages)
+#### [Languages](https://python-codext.readthedocs.io/en/latest/enc/languages.html)
 
 - [X] `braille`: well-known braille language (Python 3 only)
 - [X] `ipsum`: aka lorem ipsum
@@ -374,25 +395,31 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 - [X] `tap`: converts text to tap/knock code, commonly used by prisoners
 - [X] `tomtom`: similar to `morse`, using slashes and backslashes
 
-#### [Others](https://python-codext.readthedocs.io/en/latest/enc/others)
+#### [Others](https://python-codext.readthedocs.io/en/latest/enc/others.html)
 
+- [X] `binhex`: BinHex 4.0 (`.hqx`), the binary-to-text encoding of the classic Mac OS
 - [X] `dna`: implements the 8 rules of DNA sequences (N belongs to [1,8])
 - [X] `letter-indices`: encodes consonants and/or vowels with their corresponding indices
 - [X] `markdown`: unidirectional encoding from Markdown to HTML
+- [X] `xx`: XXencode, a UUencode variant with an alphanumeric alphabet (`+`, `-`, digits and letters)
+- [X] `yenc`: Usenet binary-to-text encoding (raw, wrapped or framed with header, trailer and CRC32)
 
-#### [Steganography](https://python-codext.readthedocs.io/en/latest/enc/stegano)
+#### [Steganography](https://python-codext.readthedocs.io/en/latest/enc/stegano.html)
 
 - [X] `hexagram`: uses Base64 and encodes the result to a charset of [I Ching hexagrams](https://en.wikipedia.org/wiki/Hexagram_%28I_Ching%29) (as implemented [here](https://github.com/qntm/hexagram-encode))
 - [X] `klopf`: aka Klopf code ; Polybius square with trivial alphabetical distribution
 - [X] `resistor`: aka resistor color codes
 - [X] `rick`: aka Rick cipher (in reference to Rick Astley's song "*Never gonna give you up*")
 - [X] `sms`: also called _T9 code_ ; uses "`-`" as a separator for encoding, "`-`" or "`_`" or whitespace for decoding
+- [X] `unicode-tags`: aka ASCII smuggling ; hides ASCII text in invisible Unicode tag characters
 - [X] `whitespace`: replaces bits with whitespaces and tabs
 - [X] `whitespace_after_before`: variant of `whitespace` ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "`whitespace+2*after-3*before`")
+- [X] `zero-width`: hides text in invisible zero-width characters (binary, ternary and quinary variants, compatible with zwsp-steg)
 
-#### [Web](https://python-codext.readthedocs.io/en/latest/enc/web)
+#### [Web](https://python-codext.readthedocs.io/en/latest/enc/web.html)
 
 - [X] `html`: implements entities according to [this reference](https://dev.w3.org/html5/html-author/charref)
 - [X] `url`: aka URL encoding
 
 
+<p align="center"><a href="#top"><img src="https://img.shields.io/badge/Back%20to%20top--lightgrey?style=social" alt="Back to top" height="20"/></a></p>

codext-2.0.0/SECURITY.md

@@ -0,0 +1,17 @@
+# Security Policy
+
+## Supported Versions
+
+Only the latest release of CodExt (`codext` on [PyPI](https://pypi.org/project/codext/)) receives security fixes.
+
+## Reporting a Vulnerability
+
+Please do **not** report security vulnerabilities through public GitHub issues.
+
+Instead, report them privately through [GitHub's private vulnerability reporting](https://github.com/dhondta/python-codext/security/advisories/new) (the repository's *Security* tab, then *Report a vulnerability*). Please include:
+
+- the CodExt and Python versions;
+- the steps to reproduce the issue (codec name, input and the command or code used);
+- the impact you expect.
+
+You will get an answer as soon as possible. Once the issue is confirmed, a fix is released and the advisory is published.