codext 1.16.0__tar.gz → 1.16.1__tar.gz

{codext-1.16.0 → codext-1.16.1}/.github/workflows/python-package.yml

@@ -18,12 +18,14 @@ jobs:
     runs-on: ubuntu-latest
     outputs:
       package: ${{ steps.pkg.outputs.package }}
+      pypi_url: ${{ steps.pkg.outputs.pypi_url }}
     steps:
       - name: Compute package name from the repository's
         id: pkg
         run: |
           name="${GITHUB_REPOSITORY##*/}"
           echo "package=${name#python-}" >> $GITHUB_OUTPUT
+          echo "pypi_url=https://pypi.org/p/${name#python-}" >> $GITHUB_OUTPUT
   build:
     needs: prepare
     runs-on: ${{ matrix.os }}
@@ -96,6 +98,9 @@ jobs:
         git commit -m "Update coverage badge"
         git push origin coverage-badge --force
   deploy:
+    environment:
+      name: pypi
+      url: ${{ needs.prepare.outputs.pypi_url }}
     runs-on: ubuntu-latest
     needs: [prepare, coverage]
     steps:

{codext-1.16.0 → codext-1.16.1}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: codext
-Version: 1.16.0
+Version: 1.16.1
 Summary: Native codecs extension
 Author-email: Alexandre D'Hondt <alexandre.dhondt@gmail.com>
 License:                     GNU GENERAL PUBLIC LICENSE
@@ -779,6 +779,8 @@ example-macro
 
 ## //img.shields.io/badge/Tweet%20(unbase)--lightgrey?logo=twitter&style=social" alt="Tweet on unbase" height="20"/></a>
 
+Playing with base encodings.
+
 ```session
 $ echo "Test string !" | base122
 *.7!ft9�-f9Â
@@ -804,9 +806,63 @@ $ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Te
 Test string !
 ```
 
+## Usage (CLI)
+
+Listing codecs.
+
+```session
+$ codext list encodings
+a1z26                      adler32               affine             alternative-rot        ascii           
+atbash                     autoclave             bacon              barbie                 base            
+base1                      base2                 base3              base4                  base8           
+<<snipped>>
+```
+
+Finding a codec based on a name.
+
+```session
+$ codext search bitcoin
+base58
+```
+
+Encoding a string.
+
+```sesssion
+$ echo -en "This is a test" | codext encode polybius
+44232443 2443 11 44154344
+```
+
+Encoding a file.
+
+```session
+$ echo -en "this is a test" > to_be_encoded.txt
+$ codext encode base64 < to_be_encoded.txt > text.b64
+$ cat text.b64 
+dGhpcyBpcyBhIHRlc3Q=
+```
+
+Chaining codecs.
+
+```session
+$ echo -en "mrdvm6teie6t2cq=" | codext encode upper | codext decode base32 | codext decode base64
+test
+```
+
+Iteratively guessing decodings.
+
+```session
+$ echo -en "test" | codext encode base64 gzip | codext guess
+Codecs: gzip
+dGVzdA==
+$ echo -en "test" | codext encode base64 gzip | codext guess gzip -i base
+Codecs: gzip, base64
+test
+```
+
+
 ## Usage (Python)
 
-Getting the list of available codecs:
+Getting the list of available codecs.
 
 ```python
 >>> import codext
@@ -814,6 +870,9 @@ Getting the list of available codecs:
 >>> codext.list()
 ['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']
 
+Playing with some base encodings.
+
+```python
 >>> codext.encode("this is a test", "base58-bitcoin")
 'jo91waLQA1NNeBmZKUF'
 
@@ -828,7 +887,21 @@ Getting the list of available codecs:
 
 >>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
 'this is a test'
+```
+
+Playing with some cryptography-based codecs.
 
+```python
+>>> codext.encode("This is a test !", "vigenere-MYSECRETKET")
+'Ffaw kj e mowm !'
+
+>>> codext.encode("This is a test !", "autoclave-SECRET")
+'Llkj ml t amkb !'
+```
+
+Encoding/decoding with various other codecs.
+
+```python
 >>> for i in range(8):
         print(codext.encode("this is a test", "dna-%d" % (i + 1)))
 GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
@@ -856,30 +929,6 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 	f.read()
 'this is a test'
 
->>> codext.decode("""
-      =            
-              X         
-   :            
-      x         
-  n  
-    r 
-        y   
-      Y            
-              y        
-     p    
-         a       
- `          
-            n            
-          |    
-  a          
-o    
-       h        
-          `            
-          g               
-           o 
-   z      """, "whitespace-after+before")
-'CSC{not_so_invisible}'
-
 >>> print(codext.encode("An example test string", "baudot-tape"))
 ***.**
    . *

{codext-1.16.0 → codext-1.16.1}/README.md

@@ -81,6 +81,8 @@ example-macro
 
 ## //img.shields.io/badge/Tweet%20(unbase)--lightgrey?logo=twitter&style=social" alt="Tweet on unbase" height="20"/></a>
 
+Playing with base encodings.
+
 ```session
 $ echo "Test string !" | base122
 *.7!ft9�-f9Â
@@ -106,9 +108,63 @@ $ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Te
 Test string !
 ```
 
+## Usage (CLI)
+
+Listing codecs.
+
+```session
+$ codext list encodings
+a1z26                      adler32               affine             alternative-rot        ascii           
+atbash                     autoclave             bacon              barbie                 base            
+base1                      base2                 base3              base4                  base8           
+<<snipped>>
+```
+
+Finding a codec based on a name.
+
+```session
+$ codext search bitcoin
+base58
+```
+
+Encoding a string.
+
+```sesssion
+$ echo -en "This is a test" | codext encode polybius
+44232443 2443 11 44154344
+```
+
+Encoding a file.
+
+```session
+$ echo -en "this is a test" > to_be_encoded.txt
+$ codext encode base64 < to_be_encoded.txt > text.b64
+$ cat text.b64 
+dGhpcyBpcyBhIHRlc3Q=
+```
+
+Chaining codecs.
+
+```session
+$ echo -en "mrdvm6teie6t2cq=" | codext encode upper | codext decode base32 | codext decode base64
+test
+```
+
+Iteratively guessing decodings.
+
+```session
+$ echo -en "test" | codext encode base64 gzip | codext guess
+Codecs: gzip
+dGVzdA==
+$ echo -en "test" | codext encode base64 gzip | codext guess gzip -i base
+Codecs: gzip, base64
+test
+```
+
+
 ## Usage (Python)
 
-Getting the list of available codecs:
+Getting the list of available codecs.
 
 ```python
 >>> import codext
@@ -116,6 +172,9 @@ Getting the list of available codecs:
 >>> codext.list()
 ['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']
 
+Playing with some base encodings.
+
+```python
 >>> codext.encode("this is a test", "base58-bitcoin")
 'jo91waLQA1NNeBmZKUF'
 
@@ -130,7 +189,21 @@ Getting the list of available codecs:
 
 >>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
 'this is a test'
+```
+
+Playing with some cryptography-based codecs.
 
+```python
+>>> codext.encode("This is a test !", "vigenere-MYSECRETKET")
+'Ffaw kj e mowm !'
+
+>>> codext.encode("This is a test !", "autoclave-SECRET")
+'Llkj ml t amkb !'
+```
+
+Encoding/decoding with various other codecs.
+
+```python
 >>> for i in range(8):
         print(codext.encode("this is a test", "dna-%d" % (i + 1)))
 GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
@@ -158,30 +231,6 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 	f.read()
 'this is a test'
 
->>> codext.decode("""
-      =            
-              X         
-   :            
-      x         
-  n  
-    r 
-        y   
-      Y            
-              y        
-     p    
-         a       
- `          
-            n            
-          |    
-  a          
-o    
-       h        
-          `            
-          g               
-           o 
-   z      """, "whitespace-after+before")
-'CSC{not_so_invisible}'
-
 >>> print(codext.encode("An example test string", "baudot-tape"))
 ***.**
    . *

codext-1.16.1/src/codext/VERSION.txt

@@ -0,0 +1 @@
+1.16.1

{codext-1.16.0 → codext-1.16.1}/src/codext/__common__.py

@@ -671,7 +671,7 @@ def list_categories():
             c.append(d.rstrip("s"))
     # particular category, hardcoded from base/_base.py
     c += ["base-generic"]
-    return c
+    return list(set(c))
 list_categories()
 
 

{codext-1.16.0 → codext-1.16.1}/src/codext/__init__.py

@@ -170,7 +170,7 @@ def main():
     listi = sparsers.add_parser("list", help="list items")
     lsparsers = listi.add_subparsers(dest="type", help="type of item to be listed", required=True)
     liste = lsparsers.add_parser("encodings", help="list encodings")
-    liste.add_argument("category", nargs="+", help="selected categories")
+    liste.add_argument("category", nargs="*", help="selected categories")
     listm = lsparsers.add_parser("macros", help="list macros")
     addm = sparsers.add_parser("add-macro", help="add a macro to the registry")
     addm.add_argument("name", help="macro's name")
@@ -198,13 +198,13 @@ def main():
         # list encodings or macros
         elif args.command == "list":
             if args.type == "encodings":
-                cats = args.category or list_categories()
-                for c in sorted(cats):
-                    l = list_encodings(c)
-                    if len(l) > 0:
-                        if len(cats) > 0:
+                if args.category:
+                    for c in sorted(args.category):
+                        if len(l := list_encodings(c)) > 0:
                             print(c.upper() + ":")
-                        __print_tabular(l)
+                            __print_tabular(l)
+                else:
+                    __print_tabular(list_encodings())
             elif args.type == "macros":
                 l = list_macros()
                 if len(l) > 0:

{codext-1.16.0 → codext-1.16.1}/src/codext.egg-info/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: codext
-Version: 1.16.0
+Version: 1.16.1
 Summary: Native codecs extension
 Author-email: Alexandre D'Hondt <alexandre.dhondt@gmail.com>
 License:                     GNU GENERAL PUBLIC LICENSE
@@ -779,6 +779,8 @@ example-macro
 
 ## //img.shields.io/badge/Tweet%20(unbase)--lightgrey?logo=twitter&style=social" alt="Tweet on unbase" height="20"/></a>
 
+Playing with base encodings.
+
 ```session
 $ echo "Test string !" | base122
 *.7!ft9�-f9Â
@@ -804,9 +806,63 @@ $ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Te
 Test string !
 ```
 
+## Usage (CLI)
+
+Listing codecs.
+
+```session
+$ codext list encodings
+a1z26                      adler32               affine             alternative-rot        ascii           
+atbash                     autoclave             bacon              barbie                 base            
+base1                      base2                 base3              base4                  base8           
+<<snipped>>
+```
+
+Finding a codec based on a name.
+
+```session
+$ codext search bitcoin
+base58
+```
+
+Encoding a string.
+
+```sesssion
+$ echo -en "This is a test" | codext encode polybius
+44232443 2443 11 44154344
+```
+
+Encoding a file.
+
+```session
+$ echo -en "this is a test" > to_be_encoded.txt
+$ codext encode base64 < to_be_encoded.txt > text.b64
+$ cat text.b64 
+dGhpcyBpcyBhIHRlc3Q=
+```
+
+Chaining codecs.
+
+```session
+$ echo -en "mrdvm6teie6t2cq=" | codext encode upper | codext decode base32 | codext decode base64
+test
+```
+
+Iteratively guessing decodings.
+
+```session
+$ echo -en "test" | codext encode base64 gzip | codext guess
+Codecs: gzip
+dGVzdA==
+$ echo -en "test" | codext encode base64 gzip | codext guess gzip -i base
+Codecs: gzip, base64
+test
+```
+
+
 ## Usage (Python)
 
-Getting the list of available codecs:
+Getting the list of available codecs.
 
 ```python
 >>> import codext
@@ -814,6 +870,9 @@ Getting the list of available codecs:
 >>> codext.list()
 ['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']
 
+Playing with some base encodings.
+
+```python
 >>> codext.encode("this is a test", "base58-bitcoin")
 'jo91waLQA1NNeBmZKUF'
 
@@ -828,7 +887,21 @@ Getting the list of available codecs:
 
 >>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
 'this is a test'
+```
+
+Playing with some cryptography-based codecs.
 
+```python
+>>> codext.encode("This is a test !", "vigenere-MYSECRETKET")
+'Ffaw kj e mowm !'
+
+>>> codext.encode("This is a test !", "autoclave-SECRET")
+'Llkj ml t amkb !'
+```
+
+Encoding/decoding with various other codecs.
+
+```python
 >>> for i in range(8):
         print(codext.encode("this is a test", "dna-%d" % (i + 1)))
 GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
@@ -856,30 +929,6 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 	f.read()
 'this is a test'
 
->>> codext.decode("""
-      =            
-              X         
-   :            
-      x         
-  n  
-    r 
-        y   
-      Y            
-              y        
-     p    
-         a       
- `          
-            n            
-          |    
-  a          
-o    
-       h        
-          `            
-          g               
-           o 
-   z      """, "whitespace-after+before")
-'CSC{not_so_invisible}'
-
 >>> print(codext.encode("An example test string", "baudot-tape"))
 ***.**
    . *

codext-1.16.0/src/codext/VERSION.txt

@@ -1 +0,0 @@
-1.16.0