RNApolis 0.8.3__tar.gz → 0.9.0__tar.gz

{rnapolis-0.8.3/src/RNApolis.egg-info → rnapolis-0.9.0}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: RNApolis
-Version: 0.8.3
+Version: 0.9.0
 Summary: A Python library containing RNA-related bioinformatics functions and classes
 Home-page: https://github.com/tzok/rnapolis-py
 Author: Tomasz Zok

{rnapolis-0.8.3 → rnapolis-0.9.0}/setup.py

@@ -5,7 +5,7 @@ with open("README.md") as f:
 
 setup(
     name="RNApolis",
-    version="0.8.3",
+    version="0.9.0",
     packages=["rnapolis"],
     package_dir={"": "src"},
     author="Tomasz Zok",

{rnapolis-0.8.3 → rnapolis-0.9.0/src/RNApolis.egg-info}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: RNApolis
-Version: 0.8.3
+Version: 0.9.0
 Summary: A Python library containing RNA-related bioinformatics functions and classes
 Home-page: https://github.com/tzok/rnapolis-py
 Author: Tomasz Zok

{rnapolis-0.8.3 → rnapolis-0.9.0}/src/RNApolis.egg-info/SOURCES.txt

@@ -23,6 +23,7 @@ src/rnapolis/molecule_filter.py
 src/rnapolis/motif_extractor.py
 src/rnapolis/parser.py
 src/rnapolis/parser_v2.py
+src/rnapolis/py.typed
 src/rnapolis/rfam_folder.py
 src/rnapolis/splitter.py
 src/rnapolis/tertiary.py

{rnapolis-0.8.3 → rnapolis-0.9.0}/src/rnapolis/adapter.py

@@ -29,8 +29,7 @@ from rnapolis.common import (
 from rnapolis.parser import read_3d_structure
 from rnapolis.tertiary import (
     Mapping2D3D,
-    Structure3D,
-    calculate_all_inter_stem_parameters,  # Import the new helper function
+    Structure3D,  # Import the new helper function
 )
 from rnapolis.util import handle_input_file
 
@@ -288,7 +287,7 @@ def parse_fr3d_output(file_path: str) -> BaseInteractions:
         BaseInteractions object containing the interactions found by FR3D
     """
     # Initialize the interaction data dictionary
-    interactions_data = {
+    interactions_data: Dict[str, list] = {
         "base_pairs": [],
         "stackings": [],
         "base_ribose_interactions": [],
@@ -320,10 +319,8 @@ def process_external_tool_output(
     structure3d: Structure3D,
     external_file_path: str,
     tool: ExternalTool,
-    model: Optional[int] = None,
     find_gaps: bool = False,
-    all_dot_brackets: bool = False,
-) -> Tuple[Structure2D, List[str], Mapping2D3D]:  # Added Mapping2D3D to return tuple
+) -> Tuple[Structure2D, Mapping2D3D]:  # Added Mapping2D3D to return tuple
     """
     Process external tool output and create a secondary structure representation.
 
@@ -336,71 +333,15 @@ def process_external_tool_output(
         tool: The external tool that generated the output (FR3D, DSSR, etc.)
         model: Model number to use (if None, use first model)
         find_gaps: Whether to detect gaps in the structure
-        all_dot_brackets: Whether to return all possible dot-bracket notations
 
     Returns:
-        A tuple containing the Structure2D object, a list of dot-bracket notations,
-        and the Mapping2D3D object.
+        A tuple containing the Structure2D object and the Mapping2D3D object.
     """
     # Parse external tool output
     base_interactions = parse_external_output(external_file_path, tool, structure3d)
 
     # Extract secondary structure using the external tool's interactions
-    return extract_secondary_structure_from_external(
-        structure3d, base_interactions, model, find_gaps, all_dot_brackets
-    )
-
-
-def extract_secondary_structure_from_external(
-    tertiary_structure: Structure3D,
-    base_interactions: BaseInteractions,
-    model: Optional[int] = None,
-    find_gaps: bool = False,
-    all_dot_brackets: bool = False,
-) -> Tuple[Structure2D, List[str], Mapping2D3D]:  # Added Mapping2D3D to return tuple
-    """
-    Create a secondary structure representation using interactions from an external tool.
-
-    Args:
-        tertiary_structure: The 3D structure parsed from PDB/mmCIF
-        base_interactions: Interactions parsed from external tool output
-        model: Model number to use (if None, use all models)
-        find_gaps: Whether to detect gaps in the structure
-        all_dot_brackets: Whether to return all possible dot-bracket notations
-
-    Returns:
-        A tuple containing the Structure2D object, a list of dot-bracket notations,
-        and the Mapping2D3D object.
-    """
-    mapping = Mapping2D3D(
-        tertiary_structure,
-        base_interactions.basePairs,
-        base_interactions.stackings,
-        find_gaps,
-    )
-    stems, single_strands, hairpins, loops = mapping.bpseq.elements
-
-    # Calculate inter-stem parameters using the helper function
-    inter_stem_params = calculate_all_inter_stem_parameters(mapping)
-
-    structure2d = Structure2D(
-        base_interactions,
-        str(mapping.bpseq),
-        mapping.dot_bracket,
-        mapping.extended_dot_bracket,
-        stems,
-        single_strands,
-        hairpins,
-        loops,
-        inter_stem_params,  # Added inter-stem parameters
-    )
-    if all_dot_brackets:
-        return structure2d, mapping.all_dot_brackets, mapping  # Return mapping
-    else:
-        return structure2d, [structure2d.dotBracket], mapping  # Return mapping
-
-
-# Removed duplicate functions - now imported from annotator
+    return structure3d.extract_secondary_structure(base_interactions, find_gaps)
 
 
 def main():
@@ -431,15 +372,18 @@ def main():
     structure3d = read_3d_structure(file, None)
 
     # Process external tool output and get secondary structure
-    structure2d, dot_brackets, mapping = process_external_tool_output(
+    structure2d, mapping = process_external_tool_output(
         structure3d,
         args.external,
         ExternalTool(args.tool),
-        None,
         args.find_gaps,
-        args.all_dot_brackets,
     )
 
+    if args.all_dot_brackets:
+        dot_brackets = mapping.all_dot_brackets
+    else:
+        dot_brackets = [mapping.dot_bracket]
+
     handle_output_arguments(args, structure2d, dot_brackets, mapping, args.input)
 
 

{rnapolis-0.8.3 → rnapolis-0.9.0}/src/rnapolis/annotator.py

@@ -1,5 +1,6 @@
 #! /usr/bin/env python
 import argparse
+import copy
 import csv
 import logging
 import math
@@ -43,7 +44,6 @@ from rnapolis.tertiary import (
     Mapping2D3D,  # Added import
     Residue3D,
     Structure3D,
-    calculate_all_inter_stem_parameters,  # Import the new helper function
     torsion_angle,
 )
 from rnapolis.util import handle_input_file
@@ -485,41 +485,6 @@ def extract_base_interactions(
     return BaseInteractions(base_pairs, stackings, base_ribose, base_phosphate, [])
 
 
-def extract_secondary_structure(
-    tertiary_structure: Structure3D,
-    model: Optional[int] = None,
-    find_gaps: bool = False,
-    all_dot_brackets: bool = False,
-) -> Tuple[Structure2D, List[str]]:
-    base_interactions = extract_base_interactions(tertiary_structure, model)
-    mapping = Mapping2D3D(
-        tertiary_structure,
-        base_interactions.basePairs,
-        base_interactions.stackings,
-        find_gaps,
-    )
-    stems, single_strands, hairpins, loops = mapping.bpseq.elements
-
-    # Calculate inter-stem parameters using the helper function
-    inter_stem_params = calculate_all_inter_stem_parameters(mapping)
-
-    structure2d = Structure2D(
-        base_interactions,
-        str(mapping.bpseq),
-        mapping.dot_bracket,
-        mapping.extended_dot_bracket,
-        stems,
-        single_strands,
-        hairpins,
-        loops,
-        inter_stem_params,  # Added inter-stem parameters
-    )
-    if all_dot_brackets:
-        return structure2d, mapping.all_dot_brackets
-    else:
-        return structure2d, [structure2d.dotBracket]
-
-
 def generate_pymol_script(mapping: Mapping2D3D, stems: List[Stem]) -> str:
     """Generates a PyMOL script to draw stems as cylinders."""
     pymol_commands = []
@@ -613,16 +578,26 @@ def generate_pymol_script(mapping: Mapping2D3D, stems: List[Stem]) -> str:
 
 
 def write_json(path: str, structure2d: Structure2D):
+    processed = copy.deepcopy(structure2d)
+    processed.bpseq_index = {
+        k: Residue(v.label, v.auth) for k, v in structure2d.bpseq_index.items()
+    }
+
     with open(path, "wb") as f:
         # Add OPT_SERIALIZE_NUMPY to handle numpy types like float64
-        f.write(orjson.dumps(structure2d, option=orjson.OPT_SERIALIZE_NUMPY))
+        # Add OPT_NON_STR_KEYS to preserve integer keys in dictionaries
+        f.write(
+            orjson.dumps(
+                processed, option=orjson.OPT_SERIALIZE_NUMPY | orjson.OPT_NON_STR_KEYS
+            )
+        )
 
 
 def write_csv(path: str, structure2d: Structure2D):
     with open(path, "w") as f:
         writer = csv.writer(f)
         writer.writerow(["nt1", "nt2", "type", "classification-1", "classification-2"])
-        for base_pair in structure2d.baseInteractions.basePairs:
+        for base_pair in structure2d.base_pairs:
             writer.writerow(
                 [
                     base_pair.nt1.full_name,
@@ -636,7 +611,7 @@ def write_csv(path: str, structure2d: Structure2D):
                     ),
                 ]
             )
-        for stacking in structure2d.baseInteractions.stackings:
+        for stacking in structure2d.stackings:
             writer.writerow(
                 [
                     stacking.nt1.full_name,
@@ -646,7 +621,7 @@ def write_csv(path: str, structure2d: Structure2D):
                     "",
                 ]
             )
-        for base_phosphate in structure2d.baseInteractions.basePhosphateInteractions:
+        for base_phosphate in structure2d.base_phosphate_interactions:
             writer.writerow(
                 [
                     base_phosphate.nt1.full_name,
@@ -656,7 +631,7 @@ def write_csv(path: str, structure2d: Structure2D):
                     "",
                 ]
             )
-        for base_ribose in structure2d.baseInteractions.baseRiboseInteractions:
+        for base_ribose in structure2d.base_ribose_interactions:
             writer.writerow(
                 [
                     base_ribose.nt1.full_name,
@@ -666,7 +641,7 @@ def write_csv(path: str, structure2d: Structure2D):
                     "",
                 ]
             )
-        for other in structure2d.baseInteractions.otherInteractions:
+        for other in structure2d.other_interactions:
             writer.writerow(
                 [
                     other.nt1.full_name,
@@ -737,12 +712,12 @@ def handle_output_arguments(
         write_bpseq(args.bpseq, structure2d.bpseq)
 
     if args.extended:
-        print(structure2d.extendedDotBracket)
+        print(structure2d.extended_dot_bracket)
     elif args.all_dot_brackets:
         for dot_bracket in dot_brackets:
             print(dot_bracket)
     else:
-        print(structure2d.dotBracket)
+        print(structure2d.dot_bracket)
 
     if args.dot:
         print(BpSeq.from_string(structure2d.bpseq).graphviz)
@@ -753,7 +728,7 @@ def handle_output_arguments(
             f.write(pml_script)
 
     if args.inter_stem_csv:
-        if structure2d.interStemParameters:
+        if structure2d.inter_stem_parameters:
             # Convert list of dataclasses to list of dicts
             params_list = [
                 {
@@ -862,16 +837,9 @@ def main():
 
     file = handle_input_file(args.input)
     structure3d = read_3d_structure(file, None)
-    structure2d, dot_brackets = extract_secondary_structure(
-        structure3d, None, args.find_gaps, args.all_dot_brackets
-    )
-
-    # Need the mapping object for PML generation
-    mapping = Mapping2D3D(
-        structure3d,
-        structure2d.baseInteractions.basePairs,
-        structure2d.baseInteractions.stackings,
-        args.find_gaps,
+    base_interactions = extract_base_interactions(structure3d)
+    structure2d, dot_brackets, mapping = structure3d.extract_secondary_structure(
+        base_interactions, args.find_gaps, args.all_dot_brackets
     )
 
     handle_output_arguments(args, structure2d, dot_brackets, mapping, args.input)

{rnapolis-0.8.3 → rnapolis-0.9.0}/src/rnapolis/common.py

@@ -1021,7 +1021,13 @@ class MultiStrandDotBracket(DotBracket):
     strands: List[Strand]
 
     @staticmethod
-    def from_string(input: str):
+    def from_string(sequence: str, structure: str):
+        # Provide compatibility with DotBracket.from_string
+        strand = Strand(1, len(sequence), sequence, structure)
+        return MultiStrandDotBracket(sequence, structure, [strand])
+
+    @staticmethod
+    def from_multiline_string(input: str):
         strands = []
         first = 1
 
@@ -1045,16 +1051,16 @@ class MultiStrandDotBracket(DotBracket):
     @staticmethod
     def from_file(path: str):
         with open(path) as f:
-            return MultiStrandDotBracket.from_string(f.read())
+            return MultiStrandDotBracket.from_multiline_string(f.read())
 
 
 @dataclass(frozen=True, order=True)
 class BaseInteractions:
-    basePairs: List[BasePair]
+    base_pairs: List[BasePair]
     stackings: List[Stacking]
-    baseRiboseInteractions: List[BaseRibose]
-    basePhosphateInteractions: List[BasePhosphate]
-    otherInteractions: List[OtherInteraction]
+    base_ribose_interactions: List[BaseRibose]
+    base_phosphate_interactions: List[BasePhosphate]
+    other_interactions: List[OtherInteraction]
 
 
 @dataclass(frozen=True, order=True)
@@ -1069,14 +1075,19 @@ class InterStemParameters:
     coaxial_probability: Optional[float]  # Probability of stems being coaxial (0-1)
 
 
-@dataclass(frozen=True, order=True)
+@dataclass
 class Structure2D:
-    baseInteractions: BaseInteractions
-    bpseq: str
-    dotBracket: str
-    extendedDotBracket: str
+    base_pairs: List[BasePair]
+    stackings: List[Stacking]
+    base_ribose_interactions: List[BaseRibose]
+    base_phosphate_interactions: List[BasePhosphate]
+    other_interactions: List[OtherInteraction]
+    bpseq: BpSeq
+    bpseq_index: Dict[int, Residue]
+    dot_bracket: MultiStrandDotBracket
+    extended_dot_bracket: str
     stems: List[Stem]
-    singleStrands: List[SingleStrand]
+    single_strands: List[SingleStrand]
     hairpins: List[Hairpin]
     loops: List[Loop]
-    interStemParameters: List[InterStemParameters]
+    inter_stem_parameters: List[InterStemParameters]

{rnapolis-0.8.3 → rnapolis-0.9.0}/src/rnapolis/tertiary.py

@@ -11,6 +11,7 @@ import numpy.typing
 from scipy.stats import vonmises
 
 from rnapolis.common import (
+    BaseInteractions,
     BasePair,
     BpSeq,
     Entry,
@@ -24,6 +25,7 @@ from rnapolis.common import (
     Stacking,
     Stem,
     Strand,
+    Structure2D,
 )
 
 BASE_ATOMS = {
@@ -456,6 +458,50 @@ class Structure3D:
             return self.residue_map.get(auth)
         return None
 
+    def extract_secondary_structure(
+        self, base_interactions: BaseInteractions, find_gaps: bool = False
+    ) -> Tuple[Structure2D, "Mapping2D3D"]:
+        """
+        Create a secondary structure representation.
+
+        Args:
+            base_interactions: Interactions
+            find_gaps: Whether to detect gaps in the structure
+            all_dot_brackets: Whether to return all possible dot-bracket notations
+
+        Returns:
+            A tuple containing the Structure2D object, a list of dot-bracket notations,
+            and the Mapping2D3D object.
+        """
+        mapping = Mapping2D3D(
+            self,
+            base_interactions.base_pairs,
+            base_interactions.stackings,
+            find_gaps,
+        )
+        stems, single_strands, hairpins, loops = mapping.bpseq.elements
+
+        # Calculate inter-stem parameters using the helper function
+        inter_stem_params = calculate_all_inter_stem_parameters(mapping)
+
+        structure2d = Structure2D(
+            base_interactions.base_pairs,
+            base_interactions.stackings,
+            base_interactions.base_ribose_interactions,
+            base_interactions.base_phosphate_interactions,
+            base_interactions.other_interactions,
+            mapping.bpseq,
+            mapping.bpseq_index_to_residue_map,
+            mapping.dot_bracket,
+            mapping.extended_dot_bracket,
+            stems,
+            single_strands,
+            hairpins,
+            loops,
+            inter_stem_params,
+        )
+        return structure2d, mapping
+
 
 @dataclass
 class Mapping2D3D:
@@ -559,46 +605,6 @@ class Mapping2D3D:
 
     @cached_property
     def bpseq(self) -> BpSeq:
-        def pair_scoring_function(pair: BasePair3D) -> int:
-            if pair.saenger is not None:
-                if pair.saenger in (Saenger.XIX, Saenger.XX):
-                    return 0, pair.nt1, pair.nt2
-                else:
-                    return 1, pair.nt1, pair.nt2
-
-            sequence = "".join(
-                sorted(
-                    [
-                        pair.nt1_3d.one_letter_name.upper(),
-                        pair.nt2_3d.one_letter_name.upper(),
-                    ]
-                )
-            )
-            if sequence in ("AU", "AT", "CG"):
-                return 0, pair.nt1, pair.nt2
-            return 1, pair.nt1, pair.nt2
-
-        canonical = [
-            base_pair
-            for base_pair in self.base_pairs
-            if base_pair.is_canonical and base_pair.nt1 < base_pair.nt2
-        ]
-
-        while True:
-            matches = defaultdict(set)
-
-            for base_pair in canonical:
-                matches[base_pair.nt1_3d].add(base_pair)
-                matches[base_pair.nt2_3d].add(base_pair)
-
-            for pairs in matches.values():
-                if len(pairs) > 1:
-                    pairs = sorted(pairs, key=pair_scoring_function)
-                    canonical.remove(pairs[-1])
-                    break
-            else:
-                break
-
         return self._generated_bpseq_data[0]
 
     @cached_property
@@ -613,9 +619,9 @@ class Mapping2D3D:
         def pair_scoring_function(pair: BasePair3D) -> int:
             if pair.saenger is not None:
                 if pair.saenger in (Saenger.XIX, Saenger.XX):
-                    return 0, pair.nt1, pair.nt2
+                    return 0
                 else:
-                    return 1, pair.nt1, pair.nt2
+                    return 1
 
             sequence = "".join(
                 sorted(
@@ -626,8 +632,8 @@ class Mapping2D3D:
                 )
             )
             if sequence in ("AU", "AT", "CG"):
-                return 0, pair.nt1, pair.nt2
-            return 1, pair.nt1, pair.nt2
+                return 0
+            return 1
 
         canonical = [
             base_pair
@@ -636,11 +642,11 @@ class Mapping2D3D:
         ]
 
         while True:
-            matches = defaultdict(set)
+            matches = defaultdict(list)
 
             for base_pair in canonical:
-                matches[base_pair.nt1_3d].add(base_pair)
-                matches[base_pair.nt2_3d].add(base_pair)
+                matches[base_pair.nt1_3d].append(base_pair)
+                matches[base_pair.nt2_3d].append(base_pair)
 
             for pairs in matches.values():
                 if len(pairs) > 1:

{rnapolis-0.8.3 → rnapolis-0.9.0}/tests/test_annotator.py

@@ -1,6 +1,6 @@
 from collections import Counter
 
-from rnapolis.annotator import extract_base_interactions, extract_secondary_structure
+from rnapolis.annotator import extract_base_interactions
 from rnapolis.parser import read_3d_structure
 
 
@@ -13,11 +13,11 @@ def test_1ehz():
     base_interactions = extract_base_interactions(structure3d, 1)
 
     interactions = [
-        base_interactions.basePairs,
+        base_interactions.base_pairs,
         base_interactions.stackings,
-        base_interactions.baseRiboseInteractions,
-        base_interactions.basePhosphateInteractions,
-        base_interactions.otherInteractions,
+        base_interactions.base_ribose_interactions,
+        base_interactions.base_phosphate_interactions,
+        base_interactions.other_interactions,
     ]
     labels = ["base pairs", "stackings", "base-ribose", "base-phosphate", "other"]
     for i in range(len(interactions)):
@@ -44,7 +44,8 @@ def test_1ehz():
 def test_8btk():
     with open("tests/8btk_B7.cif") as f:
         structure3d = read_3d_structure(f, 1)
-    assert extract_secondary_structure(structure3d, 1) is not None
+    base_interactions = extract_base_interactions(structure3d, 1)
+    assert structure3d.extract_secondary_structure(base_interactions) is not None
 
 
 def test_488d():

{rnapolis-0.8.3 → rnapolis-0.9.0}/tests/test_bugfixes.py

@@ -10,7 +10,7 @@ def test_1E7K():
         structure3d = read_3d_structure(f, 1)
     base_interaction = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interaction.basePairs, base_interaction.stackings, True
+        structure3d, base_interaction.base_pairs, base_interaction.stackings, True
     )
     assert len(mapping.strands_sequences) == 1
 
@@ -28,7 +28,7 @@ def test_1DFU():
 
     base_interactions = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
     assert b2g not in mapping.base_pair_graph[b1u]
     assert b1u not in mapping.base_pair_graph[b2g]
@@ -40,7 +40,7 @@ def test_4WTI():
         structure3d = read_3d_structure(f, 1)
     base_interactions = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
     assert mapping.dot_bracket == ">strand_T\nCGG\n.((\n>strand_P\nCC\n))"
 
@@ -51,7 +51,7 @@ def test_1HMH():
         structure3d = read_3d_structure(f, 1)
     base_interactions = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
     assert mapping.dot_bracket == ">strand_E\nUG\n.."
 
@@ -80,7 +80,7 @@ def test_6g90():
 
     # without gaps
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, False
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, False
     )
     assert (
         mapping.bpseq.sequence
@@ -90,7 +90,7 @@ def test_6g90():
 
     # with gaps
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
     assert (
         mapping.bpseq.sequence

{rnapolis-0.8.3 → rnapolis-0.9.0}/tests/test_common.py

@@ -90,11 +90,11 @@ def test_rnapdbee_adapters_api_compliance_other(obj):
 @settings(max_examples=10)
 def test_rnapdbee_adapters_api_compliance_structure2d(obj):
     assert obj.__dict__.keys() >= {
-        "basePairs",
+        "base_pairs",
         "stackings",
-        "baseRiboseInteractions",
-        "basePhosphateInteractions",
-        "otherInteractions",
+        "base_ribose_interactions",
+        "base_phosphate_interactions",
+        "other_interactions",
     }
 
 
@@ -134,7 +134,7 @@ def test_pseudoknot_order_assignment():
 
 def test_multi_strand_dot_bracket():
     input = ">strand_A\nAGCGCCUGGACUUAAAGCCAU\n..((((.((((((((((((..\n>strand_B\nGGCUUUAAGUUGACGAGGGCAGGGUUUAUCGAGACAUCGGCGGGUGCCCUGCGGUCUUCCUGCGACCGUUAGAGGACUGGUAAAACCACAGGCGACUGUGGCAUAGAGCAGUCCGGGCAGGAA\n)))))))))))..(((...[[[[[[...)))......)))))...]]]]]][[[[[.((((((]]]]].....((((((......((((((....)))))).......))))))..))))))."
-    dot_bracket = MultiStrandDotBracket.from_string(input)
+    dot_bracket = MultiStrandDotBracket.from_multiline_string(input)
     assert len(dot_bracket.strands) == 2
     assert dot_bracket.strands[0].sequence == "AGCGCCUGGACUUAAAGCCAU"
     assert dot_bracket.strands[1].sequence == (
@@ -152,7 +152,7 @@ def test_conflicted_base_pairs():
 
     base_pairs = []
 
-    for obj in data.get("basePairs", []):
+    for obj in data.get("base_pairs", []):
         nt1 = Residue(
             None,
             ResidueAuth(

{rnapolis-0.8.3 → rnapolis-0.9.0}/tests/test_quadruplexes.py

@@ -10,7 +10,7 @@ def test_2HY9():
         structure3d = read_3d_structure(f, 1)
     base_interactions = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
 
     # tract 1
@@ -63,7 +63,7 @@ def test_6RS3():
         structure3d = read_3d_structure(f, 1)
     base_interactions = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
 
     g1 = structure3d.find_residue(ResidueLabel("A", 1, "DG"), None)
@@ -108,7 +108,7 @@ def test_1JJP():
         structure3d = read_3d_structure(f, 1)
     base_interactions = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
 
     ag1 = structure3d.find_residue(ResidueLabel("A", 1, "DG"), None)
@@ -182,7 +182,7 @@ def test_6FC9():
         structure3d = read_3d_structure(f, 1)
     base_interactions = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
 
     g1 = structure3d.find_residue(ResidueLabel("A", 1, "DG"), None)
@@ -258,7 +258,7 @@ def test_UGG_md():
         structure3d = read_3d_structure(f, 1)
     base_interactions = extract_base_interactions(structure3d)
     mapping = Mapping2D3D(
-        structure3d, base_interactions.basePairs, base_interactions.stackings, True
+        structure3d, base_interactions.base_pairs, base_interactions.stackings, True
     )
 
     u1 = structure3d.find_residue(None, ResidueAuth(" ", 1, None, "U5"))