PyPyNum 1.17.1__tar.gz → 1.17.2__tar.gz

{pypynum-1.17.1 → pypynum-1.17.2}/PKG-INFO

@@ -1,7 +1,7 @@
 Metadata-Version: 2.1
 Name: PyPyNum
-Version: 1.17.1
-Summary: PyPyNum is a Python library for math & science computations, covering algebra, calculus, stats, with data structures like matrices, vectors, tensors. It offers numerical tools, programs, and supports computational ops, functions, processing, simulation, & visualization in data science & ML, crucial for research, engineering, & data processing.
+Version: 1.17.2
+Summary: PyPyNum is a multifunctional Python math lib. It includes modules for math, data analysis, array ops, crypto, physics, randomness, data prep, stats, solving eqns, image processing, interp, matrix calc, and high-precision math. Designed for scientific computing, data science, and machine learning, PyPyNum provides efficient and versatile tools.
 Home-page: https://github.com/PythonSJL/PyPyNum
 Author: Shen Jiayi
 Author-email: 2261748025@qq.com
@@ -692,7 +692,7 @@ scientific computing, data science, and machine learning, PyPyNum provides effic
 [![Downloads](https://static.pepy.tech/badge/pypynum/month)](https://pepy.tech/project/pypynum)
 [![Downloads](https://static.pepy.tech/badge/pypynum/week)](https://pepy.tech/project/pypynum)
 
-## Version -> 1.17.1 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
+## Version -> 1.17.2 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
 
 ![LOGO](PyPyNum.png)
 
@@ -824,71 +824,51 @@ Python interpreter and run it!
 ```
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 
-The `pypynum.images` module
-now encompasses three classes,
-expanding its image processing functionality.
-The original `PNG` class
-has been transformed to be based on
-the `BaseImage` class.
-This update includes a specific fix
-for the `read` method in `PNG`,
-addressing issues with reading
-large images.
-1. `BaseImage`: A foundational class
-for image processing, offering
-basic methods like image creation,
-pixel access, and metadata retrieval.
-2. `BMP`: A subclass of `BaseImage`,
-tailored for BMP image handling,
-providing specialized BMP functionalities.
-3. `PNG`: The `PNG` class, now built on
-`BaseImage`, with an improved `read`
-method that solves the problem of
-reading large PNG files.
-This fix to the `read` method in `PNG`
-ensures efficient processing of large images,
-maintaining image quality and integrity.
-The module's enhanced capabilities
-make it more robust and user-friendly
-for handling substantial PNG files.
+Fixed some known issues.
+
+!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
+
+The pypynum.utils module has recently introduced a new class
+called RadixInt. This class is designed to facilitate the
+representation and manipulation of integers in various bases,
+ranging from base 2 to base 36.
+
+The RadixInt class within the pypynum.utils module provides a
+robust way to work with integers in custom bases. It allows
+users to initialize instances with either a decimal number or a
+string representation of a number in the desired base. The class
+supports conversion between different bases, as well as basic
+arithmetic operations that can be performed on integers
+represented in various bases.
 
 
 <<< The following are some usage examples >>>
 
 
-# Import BMP and PNG classes
-from pypynum import BMP, PNG
-
-# Instantiate BMP class
-bmp_image = BMP()
-# Instantiate a BMP image with specified dimensions and color
-bmp_image.new(width=100, height=100, color=(255, 0, 0), color_mode="RGB", bit_depth=8)
-# Set pixel color at (50, 50) to blue
-bmp_image[50, 50] = (0, 0, 255)
-# Save the BMP image
-bmp_image.write("output_bmp.bmp")
-# Instantiate PNG class
-png_image = PNG()
-# Instantiate a PNG image with specified dimensions and color
-png_image.new(width=100, height=100, color=(0, 255, 0), color_mode="RGB", bit_depth=8)
-# Set pixel color at (50, 50) to yellow
-png_image[50, 50] = (255, 255, 0)
-# Save the PNG image
-png_image.write("output_png.png")
-# Create BMP reader to read the BMP image
-bmp_reader = BMP()
-# Read the BMP image from the file
-bmp_reader.read("output_bmp.bmp")
-# Print the BMP image and pixel at (50, 50)
-print("BMP Image:", bmp_reader)
-print("BMP Pixel at (50, 50):", bmp_reader[50, 50])
-# Create PNG reader to read the PNG image
-png_reader = PNG()
-# Read the PNG image from the file
-png_reader.read("output_png.png")
-# Print the PNG image and pixel at (50, 50)
-print("PNG Image:", png_reader)
-print("PNG Pixel at (50, 50):", png_reader[50, 50])
+from pypynum import RadixInt
+
+# Base-2 and base-10 numbers
+binary_num = RadixInt("1010", 2)
+decimal_num = RadixInt(10, 10)
+print(binary_num)  # Output: (1010)_{2}
+print(decimal_num)  # Output: (10)_{10}
+binary_to_octal = RadixInt("1010", 2).to_base(8)
+print(binary_to_octal)  # Output: (12)_{8}
+# Addition
+result_add = binary_num + decimal_num
+print(result_add)  # Output: (20)_{10}
+# Base-8 and base-10 numbers
+octal_num = RadixInt("123", 8)
+decimal_num = RadixInt(5, 10)
+# Subtraction
+result_sub = octal_num - decimal_num
+print(result_sub)  # Output: (78)_{10}
+# Base-16 and base-2 numbers
+hex_num = RadixInt("1A", 16)
+binary_num = RadixInt("11", 2)
+# Multiplication
+result_mul = hex_num * binary_num
+print(result_mul)  # Output: (78)_{10}
 
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 ```

{pypynum-1.17.1 → pypynum-1.17.2}/PyPyNum.egg-info/PKG-INFO

@@ -1,7 +1,7 @@
 Metadata-Version: 2.1
 Name: PyPyNum
-Version: 1.17.1
-Summary: PyPyNum is a Python library for math & science computations, covering algebra, calculus, stats, with data structures like matrices, vectors, tensors. It offers numerical tools, programs, and supports computational ops, functions, processing, simulation, & visualization in data science & ML, crucial for research, engineering, & data processing.
+Version: 1.17.2
+Summary: PyPyNum is a multifunctional Python math lib. It includes modules for math, data analysis, array ops, crypto, physics, randomness, data prep, stats, solving eqns, image processing, interp, matrix calc, and high-precision math. Designed for scientific computing, data science, and machine learning, PyPyNum provides efficient and versatile tools.
 Home-page: https://github.com/PythonSJL/PyPyNum
 Author: Shen Jiayi
 Author-email: 2261748025@qq.com
@@ -692,7 +692,7 @@ scientific computing, data science, and machine learning, PyPyNum provides effic
 [![Downloads](https://static.pepy.tech/badge/pypynum/month)](https://pepy.tech/project/pypynum)
 [![Downloads](https://static.pepy.tech/badge/pypynum/week)](https://pepy.tech/project/pypynum)
 
-## Version -> 1.17.1 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
+## Version -> 1.17.2 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
 
 ![LOGO](PyPyNum.png)
 
@@ -824,71 +824,51 @@ Python interpreter and run it!
 ```
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 
-The `pypynum.images` module
-now encompasses three classes,
-expanding its image processing functionality.
-The original `PNG` class
-has been transformed to be based on
-the `BaseImage` class.
-This update includes a specific fix
-for the `read` method in `PNG`,
-addressing issues with reading
-large images.
-1. `BaseImage`: A foundational class
-for image processing, offering
-basic methods like image creation,
-pixel access, and metadata retrieval.
-2. `BMP`: A subclass of `BaseImage`,
-tailored for BMP image handling,
-providing specialized BMP functionalities.
-3. `PNG`: The `PNG` class, now built on
-`BaseImage`, with an improved `read`
-method that solves the problem of
-reading large PNG files.
-This fix to the `read` method in `PNG`
-ensures efficient processing of large images,
-maintaining image quality and integrity.
-The module's enhanced capabilities
-make it more robust and user-friendly
-for handling substantial PNG files.
+Fixed some known issues.
+
+!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
+
+The pypynum.utils module has recently introduced a new class
+called RadixInt. This class is designed to facilitate the
+representation and manipulation of integers in various bases,
+ranging from base 2 to base 36.
+
+The RadixInt class within the pypynum.utils module provides a
+robust way to work with integers in custom bases. It allows
+users to initialize instances with either a decimal number or a
+string representation of a number in the desired base. The class
+supports conversion between different bases, as well as basic
+arithmetic operations that can be performed on integers
+represented in various bases.
 
 
 <<< The following are some usage examples >>>
 
 
-# Import BMP and PNG classes
-from pypynum import BMP, PNG
-
-# Instantiate BMP class
-bmp_image = BMP()
-# Instantiate a BMP image with specified dimensions and color
-bmp_image.new(width=100, height=100, color=(255, 0, 0), color_mode="RGB", bit_depth=8)
-# Set pixel color at (50, 50) to blue
-bmp_image[50, 50] = (0, 0, 255)
-# Save the BMP image
-bmp_image.write("output_bmp.bmp")
-# Instantiate PNG class
-png_image = PNG()
-# Instantiate a PNG image with specified dimensions and color
-png_image.new(width=100, height=100, color=(0, 255, 0), color_mode="RGB", bit_depth=8)
-# Set pixel color at (50, 50) to yellow
-png_image[50, 50] = (255, 255, 0)
-# Save the PNG image
-png_image.write("output_png.png")
-# Create BMP reader to read the BMP image
-bmp_reader = BMP()
-# Read the BMP image from the file
-bmp_reader.read("output_bmp.bmp")
-# Print the BMP image and pixel at (50, 50)
-print("BMP Image:", bmp_reader)
-print("BMP Pixel at (50, 50):", bmp_reader[50, 50])
-# Create PNG reader to read the PNG image
-png_reader = PNG()
-# Read the PNG image from the file
-png_reader.read("output_png.png")
-# Print the PNG image and pixel at (50, 50)
-print("PNG Image:", png_reader)
-print("PNG Pixel at (50, 50):", png_reader[50, 50])
+from pypynum import RadixInt
+
+# Base-2 and base-10 numbers
+binary_num = RadixInt("1010", 2)
+decimal_num = RadixInt(10, 10)
+print(binary_num)  # Output: (1010)_{2}
+print(decimal_num)  # Output: (10)_{10}
+binary_to_octal = RadixInt("1010", 2).to_base(8)
+print(binary_to_octal)  # Output: (12)_{8}
+# Addition
+result_add = binary_num + decimal_num
+print(result_add)  # Output: (20)_{10}
+# Base-8 and base-10 numbers
+octal_num = RadixInt("123", 8)
+decimal_num = RadixInt(5, 10)
+# Subtraction
+result_sub = octal_num - decimal_num
+print(result_sub)  # Output: (78)_{10}
+# Base-16 and base-2 numbers
+hex_num = RadixInt("1A", 16)
+binary_num = RadixInt("11", 2)
+# Multiplication
+result_mul = hex_num * binary_num
+print(result_mul)  # Output: (78)_{10}
 
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 ```

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/README.md

@@ -19,7 +19,7 @@ scientific computing, data science, and machine learning, PyPyNum provides effic
 [![Downloads](https://static.pepy.tech/badge/pypynum/month)](https://pepy.tech/project/pypynum)
 [![Downloads](https://static.pepy.tech/badge/pypynum/week)](https://pepy.tech/project/pypynum)
 
-## Version -> 1.17.1 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
+## Version -> 1.17.2 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
 
 ![LOGO](PyPyNum.png)
 
@@ -151,71 +151,51 @@ Python interpreter and run it!
 ```
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 
-The `pypynum.images` module
-now encompasses three classes,
-expanding its image processing functionality.
-The original `PNG` class
-has been transformed to be based on
-the `BaseImage` class.
-This update includes a specific fix
-for the `read` method in `PNG`,
-addressing issues with reading
-large images.
-1. `BaseImage`: A foundational class
-for image processing, offering
-basic methods like image creation,
-pixel access, and metadata retrieval.
-2. `BMP`: A subclass of `BaseImage`,
-tailored for BMP image handling,
-providing specialized BMP functionalities.
-3. `PNG`: The `PNG` class, now built on
-`BaseImage`, with an improved `read`
-method that solves the problem of
-reading large PNG files.
-This fix to the `read` method in `PNG`
-ensures efficient processing of large images,
-maintaining image quality and integrity.
-The module's enhanced capabilities
-make it more robust and user-friendly
-for handling substantial PNG files.
+Fixed some known issues.
+
+!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
+
+The pypynum.utils module has recently introduced a new class
+called RadixInt. This class is designed to facilitate the
+representation and manipulation of integers in various bases,
+ranging from base 2 to base 36.
+
+The RadixInt class within the pypynum.utils module provides a
+robust way to work with integers in custom bases. It allows
+users to initialize instances with either a decimal number or a
+string representation of a number in the desired base. The class
+supports conversion between different bases, as well as basic
+arithmetic operations that can be performed on integers
+represented in various bases.
 
 
 <<< The following are some usage examples >>>
 
 
-# Import BMP and PNG classes
-from pypynum import BMP, PNG
-
-# Instantiate BMP class
-bmp_image = BMP()
-# Instantiate a BMP image with specified dimensions and color
-bmp_image.new(width=100, height=100, color=(255, 0, 0), color_mode="RGB", bit_depth=8)
-# Set pixel color at (50, 50) to blue
-bmp_image[50, 50] = (0, 0, 255)
-# Save the BMP image
-bmp_image.write("output_bmp.bmp")
-# Instantiate PNG class
-png_image = PNG()
-# Instantiate a PNG image with specified dimensions and color
-png_image.new(width=100, height=100, color=(0, 255, 0), color_mode="RGB", bit_depth=8)
-# Set pixel color at (50, 50) to yellow
-png_image[50, 50] = (255, 255, 0)
-# Save the PNG image
-png_image.write("output_png.png")
-# Create BMP reader to read the BMP image
-bmp_reader = BMP()
-# Read the BMP image from the file
-bmp_reader.read("output_bmp.bmp")
-# Print the BMP image and pixel at (50, 50)
-print("BMP Image:", bmp_reader)
-print("BMP Pixel at (50, 50):", bmp_reader[50, 50])
-# Create PNG reader to read the PNG image
-png_reader = PNG()
-# Read the PNG image from the file
-png_reader.read("output_png.png")
-# Print the PNG image and pixel at (50, 50)
-print("PNG Image:", png_reader)
-print("PNG Pixel at (50, 50):", png_reader[50, 50])
+from pypynum import RadixInt
+
+# Base-2 and base-10 numbers
+binary_num = RadixInt("1010", 2)
+decimal_num = RadixInt(10, 10)
+print(binary_num)  # Output: (1010)_{2}
+print(decimal_num)  # Output: (10)_{10}
+binary_to_octal = RadixInt("1010", 2).to_base(8)
+print(binary_to_octal)  # Output: (12)_{8}
+# Addition
+result_add = binary_num + decimal_num
+print(result_add)  # Output: (20)_{10}
+# Base-8 and base-10 numbers
+octal_num = RadixInt("123", 8)
+decimal_num = RadixInt(5, 10)
+# Subtraction
+result_sub = octal_num - decimal_num
+print(result_sub)  # Output: (78)_{10}
+# Base-16 and base-2 numbers
+hex_num = RadixInt("1A", 16)
+binary_num = RadixInt("11", 2)
+# Multiplication
+result_mul = hex_num * binary_num
+print(result_mul)  # Output: (78)_{10}
 
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 ```

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/__init__.py

@@ -11,9 +11,9 @@ r"""
 PyPyNum
 ==========
 
-PyPyNum is a Python library for math & science computations, covering algebra, calculus, stats, with data structures
-like matrices, vectors, tensors. It offers numerical tools, programs, and supports computational ops, functions,
-processing, simulation, & visualization in data science & ML, crucial for research, engineering, & data processing.
+PyPyNum is a multifunctional Python math lib. It includes modules for math, data analysis, array ops, crypto,
+physics, randomness, data prep, stats, solving eqns, image processing, interp, matrix calc, and high-precision math.
+Designed for scientific computing, data science, and machine learning, PyPyNum provides efficient and versatile tools.
 
 Copyright
 ==========
@@ -68,7 +68,7 @@ from .ufuncs import *
 from .utils import *
 from .vectors import *
 
-__version__ = "1.17.1"
+__version__ = "1.17.2"
 print("PyPyNum", "Version -> " + __version__, "PyPI -> https://pypi.org/project/PyPyNum/",
       "Gitee -> https://www.gitee.com/PythonSJL/PyPyNum", "GitHub -> https://github.com/PythonSJL/PyPyNum", sep=" | ")
 for key, value in tuple(globals().items()):

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/dists.py

@@ -57,7 +57,7 @@ def cauchy_pdf(x, x0, gamma):
     Cauchy probability density function
 
     Example
-    =========
+    ==========
     >>> cauchy_pdf(0, 0, 1)
     0.3183098861837907
     >>>
@@ -74,10 +74,12 @@ def cauchy_pdf(x, x0, gamma):
 
 def cauchy_cdf(x, x0, gamma):
     """
+    Introduction
+    ==========
     Cauchy cumulative distribution function
 
     Example
-    =========
+    ==========
     >>> cauchy_cdf(0, 0, 1)
     0.5
     >>>
@@ -133,8 +135,8 @@ def chi2_cdf(x, df=1):
     :return: The probability density at x for the Chi-squared distribution with df degrees of freedom.
     """
     from math import gamma
-    from .maths import lower_gamma
-    return lower_gamma(df / 2, x / 2) / gamma(df / 2)
+    from .maths import lowergamma
+    return lowergamma(df / 2, x / 2) / gamma(df / 2)
 
 
 def expon_pdf(x, scale=1.0):
@@ -291,7 +293,7 @@ def invgauss_pdf(x, mu, lambda_, alpha):
     Inverse Gaussian (inverse normal) probability density function
 
     Example
-    =========
+    ==========
     >>> invgauss_pdf(1, 1, 1, 1)
     0.3989422804014327
     >>>
@@ -317,7 +319,7 @@ def levy_pdf(x, c):
     Lévy probability density function
 
     Example
-    =========
+    ==========
     >>> levy_pdf(1, 1)
     0.24197072451914337
     >>>
@@ -339,7 +341,7 @@ def log_logistic_pdf(x, alpha, beta):
     Log-logistic probability density function
 
     Example
-    =========
+    ==========
     >>> log_logistic_pdf(1, 1, 1)
     0.25
     >>>
@@ -363,7 +365,7 @@ def log_logistic_cdf(x, alpha, beta):
     Log-logistic cumulative distribution function
 
     Example
-    =========
+    ==========
     >>> log_logistic_cdf(1, 1, 1)
     0.5906161091496412
     >>>
@@ -387,7 +389,7 @@ def logistic_pdf(x, mu=0, s=1):
     Logistic probability density function
 
     Example
-    =========
+    ==========
     >>> logistic_pdf(0, 0, 1)
     0.25
     >>>
@@ -409,7 +411,7 @@ def logistic_cdf(x, mu=0, s=1):
     Logistic cumulative distribution function
 
     Example
-    =========
+    ==========
     >>> logistic_cdf(0, 0, 1)
     0.5
     >>>
@@ -502,7 +504,7 @@ def multinomial_pmf(k, n, p):
     Multinomial probability mass function
 
     Example
-    =========
+    ==========
     >>> multinomial_pmf([2, 1, 0], 3, [0.5, 0.4, 0.1])
     0.30000000000000004
     >>>
@@ -636,7 +638,7 @@ def pareto_pdf(x, k, m):
     Pareto probability density function
 
     Example
-    =========
+    ==========
     >>> pareto_pdf(10, 2, 5)
     0.00040000000000000013
     >>>
@@ -679,7 +681,7 @@ def rayleigh_pdf(x, sigma):
     Rayleigh probability density function
 
     Example
-    =========
+    ==========
     >>> rayleigh_pdf(1, 1)
     0.6065306597126334
     >>>
@@ -840,7 +842,7 @@ def zipf_pmf(k, s, n):
     Zipf probability mass function
 
     Example
-    =========
+    ==========
     >>> zipf_pmf(1, 1, 10)
     0.34141715214740553
     >>>

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/files.py

@@ -1,6 +1,6 @@
 def read(file: str) -> list:
     """
-    Read and parse files with the suffix ".pypynum"
+    Read and parse files with the suffix ".ppn"
     :param file: string
     :return:
     """
@@ -11,15 +11,15 @@ def read(file: str) -> list:
         "from .vectors import Vector",
         "from .geoms import Point, Line, Triangle, Quadrilateral, Polygon, Circle",
         "from .groups import Group",
-        "from .quats import Quaternion, Euler",
+        "from .hypcmpnms import Quaternion, Euler, Octonion",
         "from .polys import Polynomial"
     ]))
-    suffix = ".pypynum"
+    suffix = ".ppn"
     if not file.endswith(suffix):
         raise FileExistsError("The file extension can only be '{}'".format(suffix))
     result = []
     with open(file, "r") as r:
-        data = [item.split("\\") for item in r.read().split("\n") if item]
+        data = [item.split("\\", 1) for item in r.read().split("\n") if item]
     for item in data:
         try:
             result.append(eval("{}(*{})".format(item[0], item[1])))
@@ -30,7 +30,7 @@ def read(file: str) -> list:
 
 def write(file: str, *cls: object):
     """
-    Save data to a file with the suffix ".pypynum"
+    Save data to a file with the suffix ".ppn"
     :param file: string
     :param cls: instance
     :return:
@@ -38,9 +38,9 @@ def write(file: str, *cls: object):
     from .arrays import Array
     from .geoms import Point, Line, Triangle, Quadrilateral, Polygon, Circle
     from .groups import Group
-    from .quats import Quaternion, Euler
+    from .hypcmpnms import Quaternion, Euler, Octonion
     from .polys import Polynomial
-    suffix = ".pypynum"
+    suffix = ".ppn"
     if not file.endswith(suffix):
         raise FileExistsError("The file extension can only be '{}'".format(suffix))
     with open(file, "w") as w:
@@ -65,7 +65,7 @@ def write(file: str, *cls: object):
                 w.write("{}\\{}\n".format(prefix, str([item.center, item.radius]).replace(" ", "")))
             elif isinstance(item, Group):
                 w.write("{}\\{}\n".format(prefix, str([item.elements()]).replace(" ", "")))
-            elif isinstance(item, (Quaternion, Euler)):
+            elif isinstance(item, (Quaternion, Euler, Octonion)):
                 w.write("{}\\{}\n".format(prefix, str(item.data()).replace(" ", "")))
             elif isinstance(item, Polynomial):
                 w.write("{}\\{}\n".format(prefix, str([item.terms]).replace(" ", "")))

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/maths.py

@@ -59,7 +59,7 @@ def uppergamma(s: num, x: num) -> num:
     return math.gamma(s) - lowergamma(s, x)
 
 
-def sumprod(*arrays: arr) -> num:
+def sumprod(*arrays: arr, floating: bool = False) -> num:
     """
     Introduction
     ==========
@@ -70,10 +70,12 @@ def sumprod(*arrays: arr) -> num:
     >>> sumprod([1, 2, 3], [4, 5, 6], [7, 8, 9])
     270.0
     >>>
-    :param arrays: list | tuple
-    :return:
+    :param arrays: A variable number of sequences.
+    :param floating: If True, use math.fsum for summing the products. Defaults to False.
+    :return: The sum of the product of corresponding elements.
     """
-    return math.fsum(map(product, zip(*arrays)))
+    f = math.fsum if floating else sum
+    return f(map(product, zip(*arrays)))
 
 
 def xlogy(x: num, y: num) -> num:
@@ -537,7 +539,7 @@ def mode(data: arr):
 def mean(numbers: arr) -> num:
     """
     Introduction
-    ===========
+    ==========
     Calculate the arithmetic mean of a sequence of numbers.
 
     The arithmetic mean is the sum of the numbers divided by the count of numbers.
@@ -556,7 +558,7 @@ def mean(numbers: arr) -> num:
 def geom_mean(numbers: arr) -> num:
     """
     Introduction
-    ===========
+    ==========
     Calculate the geometric mean of a sequence of numbers.
 
     The geometric mean is the nth root of the product of the numbers, where n is the count of numbers.
@@ -575,7 +577,7 @@ def geom_mean(numbers: arr) -> num:
 def square_mean(numbers: arr) -> num:
     """
     Introduction
-    ===========
+    ==========
     Calculate the square mean of a sequence of numbers.
 
     The square mean is the square root of the average of the squares of the numbers.
@@ -594,7 +596,7 @@ def square_mean(numbers: arr) -> num:
 def harm_mean(numbers: arr) -> num:
     """
     Introduction
-    ===========
+    ==========
     Calculate the harmonic mean of a sequence of numbers.
 
     The harmonic mean is the reciprocal of the arithmetic mean of the reciprocals of the numbers.
@@ -613,7 +615,7 @@ def harm_mean(numbers: arr) -> num:
 def power_mean(numbers: arr, p: num) -> num:
     """
     Introduction
-    ===========
+    ==========
     Calculate the power mean of a sequence of numbers with an exponent p.
 
     The power mean is the p-th root of the average of the numbers raised to the power p.
@@ -1514,8 +1516,8 @@ def is_square(n: int) -> bool:
     """
     if is_possibly_square(n):
         try:
-            from math import isqrt as f
-        except ImportError:
+            f = math.isqrt
+        except AttributeError:
             f = isqrt
         sqrt = f(n)
         return sqrt * sqrt == n

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/multiprec.py

@@ -507,10 +507,11 @@ class MPComplex:
         return MPComplex(self.real, -self.imag, self.sigfigs)
 
     def modulus(self, sigfigs=None):
-        if sigfigs is not None:
-            _setprec(sigfigs)
+        if sigfigs is None:
+            sigfigs = self.sigfigs
+        _setprec(sigfigs + 5)
         mod = (self.real ** 2 + self.imag ** 2).sqrt()
-        _setprec(self.sigfigs)
+        _setprec(sigfigs)
         return +mod
 
     def __abs__(self):

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/tools.py

@@ -601,7 +601,7 @@ def kmp_table(pattern: ite) -> list:
     comparisons after a mismatch. This table determines how many characters can be skipped after a mismatch.
 
     Example
-    ========
+    ==========
     >>> kmp_table("AGCTGATCGTACGTAAGCTAGCTA")
     [0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 2, 3, 4, 1, 2, 3, 4, 1]
     >>>
@@ -634,7 +634,7 @@ def findall(seq: ite, pat: ite) -> list:
     of specified subsequences. It allows overlapping matches.
 
     Example
-    ========
+    ==========
     >>> findall([2, 1, 2, 1, 2, 1, 2, 1], [1, 2, 1, 2])
     [1, 3]
     >>>

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/utils.py

@@ -633,3 +633,85 @@ class IntervalSet:
         formatted_intervals = [format_interval(*interval) for interval in intervals]
         union = " \\cup " if use_latex else " ∪ " if config.use_unicode else " U "
         return union.join(formatted_intervals)
+
+
+class RadixInt:
+    __digits = "0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ"
+
+    def __init__(self, number, base):
+        """
+        Represents an integer in a specified base.
+        :param number: The integer or string representation of the number to be converted.
+        :param base: The base of the number, which must be an integer between 2 and 36.
+        """
+        self.base = int(base)
+        if not 2 <= self.base <= 36:
+            raise ValueError("Base must be between 2 and 36.")
+        number = str(number)
+        self.negative = number[0] == "-"
+        if self.negative:
+            number = number[1:]
+        self.number = number.upper()
+        valid = self.__digits[:self.base]
+        if not all([char in valid for char in self.number]):
+            raise ValueError("The number {} is not valid in base {}.".format(self.number, self.base))
+
+    def __repr__(self):
+        return "({})_{{{}}}".format("-" + self.number if self.negative else self.number, self.base)
+
+    def to_decimal(self):
+        return (-1 if self.negative else 1) * int(self.number, self.base)
+
+    def to_base(self, new_base):
+        if new_base == self.base:
+            return RadixInt(self.number, self.base)
+        decimal_value = self.to_decimal()
+        if new_base == 10:
+            return RadixInt(decimal_value, 10)
+        else:
+            result = ""
+            is_negative = self.negative
+            decimal_value = abs(decimal_value)
+            while decimal_value > 0:
+                remainder = decimal_value % new_base
+                result = self.__digits[remainder] + result
+                decimal_value //= new_base
+            result = result or "0"
+            if is_negative:
+                result = "-" + result
+            return RadixInt(result, new_base)
+
+    def __calculate(self, other, operation):
+        if not isinstance(other, RadixInt):
+            other = RadixInt(other, 10)
+        decimal_result = operation(self.to_decimal(), other.to_decimal())
+        result_base = self.base if self.base == other.base else 10
+        return RadixInt(decimal_result, 10).to_base(result_base)
+
+    def __add__(self, other):
+        return self.__calculate(other, lambda x, y: x + y)
+
+    def __sub__(self, other):
+        return self.__calculate(other, lambda x, y: x - y)
+
+    def __mul__(self, other):
+        return self.__calculate(other, lambda x, y: x * y)
+
+    def __floordiv__(self, other):
+        return self.__calculate(other, lambda x, y: x // y)
+
+    def __mod__(self, other):
+        return self.__calculate(other, lambda x, y: x % y)
+
+    def __truediv__(self, other):
+        return NotImplemented
+
+    def __pow__(self, power, modulo=None):
+        if isinstance(power, RadixInt):
+            power = power.to_decimal()
+        if power < 0:
+            return NotImplemented
+        result = self.__calculate(power, lambda x, y: x ** y)
+        if modulo is not None:
+            result = result % modulo
+        return result

{pypynum-1.17.1 → pypynum-1.17.2}/pypynum/zh_cn.py

@@ -217,11 +217,11 @@ def 转为多精度复数(实部: Union[int, float, str, Decimal, complex, MPCom
 
 
 def 下伽玛(s: num, x: num) -> num:
-    return lower_gamma(s, x)
+    return lowergamma(s, x)
 
 
 def 上伽玛(s: num, x: num) -> num:
-    return upper_gamma(s, x)
+    return uppergamma(s, x)
 
 
 def 贝塞尔函数J0(x: num) -> num:

{pypynum-1.17.1 → pypynum-1.17.2}/setup.py

@@ -19,16 +19,16 @@ with open("AGPLv3", "r", encoding="UTF-8") as r:
 
 setup(
     name="PyPyNum",
-    version="1.17.1",
+    version="1.17.2",
     packages=find_packages(),
     url="https://github.com/PythonSJL/PyPyNum",
     license=LICENSE,
     author="Shen Jiayi",
     author_email="2261748025@qq.com",
-    description="PyPyNum is a Python library for math & science computations, covering algebra, calculus, stats, "
-                "with data structures like matrices, vectors, tensors. It offers numerical tools, programs, "
-                "and supports computational ops, functions, processing, simulation, & visualization in data science & "
-                "ML, crucial for research, engineering, & data processing.",
+    description="PyPyNum is a multifunctional Python math lib. It includes modules for math, data analysis, array ops, "
+                "crypto, physics, randomness, data prep, stats, solving eqns, image processing, interp, matrix calc, "
+                "and high-precision math. Designed for scientific computing, data science, and machine learning, "
+                "PyPyNum provides efficient and versatile tools.",
     python_requires=">=3.4",
     package_data={"pypynum": ["*"]},
     long_description=md,