viral_seq 0.3.2 → 1.0.0

checksums.yaml

@@ -1,7 +1,7 @@
 ---
 SHA256:
-  metadata.gz: 97c823fe653d6655cf938120d163befe805933463dfe339811e115e89f5aac3b
-  data.tar.gz: df185d45cae565437b54f43a1a03b44186e3295c95732effe1383a32a3c916d9
+  metadata.gz: 9055ee4b893bdff77117a2a9c005166637c177b0ed243a5362488ccf7d893e76
+  data.tar.gz: 87faa7b60c47eecc6f1e3267d4f2a0df549dc70d935d8adabaf54994e60b8ab4
 SHA512:
-  metadata.gz: 6d8652dc6bafe65d9dd42f46aad49c5d8f4a9788760575fd28586462e3781b8c47d618e6891539f91f7c9a0a782934b9b56e24220eac834dbb8d6ca1aeca4c50
-  data.tar.gz: 1d36a265a5af049f563ec87bed6517d32e015c42108558e63de5fea272ebcf92f5262ff6ed96f1b2c31eb36e1a4aaa9beb00d40bf89a4f5d6ca4fe1809b1bbcb
+  metadata.gz: c5a3d9aab73cd1e8b696527392c6caaa0a4eec485fe0dbf38a7db456ddce115288f2ae735717ec9595cc4f732cb6afee8dca750b0ebfc703112a5df7196230ca
+  data.tar.gz: f0f040bb1c70f3569ae132023f367f945c408ba73d8d495976ceb0cc2538d7104a56f2009f89789eacbfe45921c017e40578fcb4ccd1df489f75d83d7b733a85

data/Gemfile.lock

@@ -1,7 +1,7 @@
 PATH
   remote: .
   specs:
-    viral_seq (0.3.0)
+    viral_seq (1.0.0)
       muscle_bio (~> 0.4)
 
 GEM

data/README.md

@@ -1,4 +1,4 @@
-# viral_seq
+# ViralSeq
 
 A Ruby Gem containing bioinformatics tools for processing viral NGS data.
 
@@ -15,6 +15,12 @@ Load all ViralSeq classes by requiring 'viral_seq.rb'
     #!/usr/bin/env ruby
     require 'viral_seq'
 
+## Updates
+
+Version 1.0.0-07092019:
+
+    1. Rewrote the whole ViralSeq gem, grouping methods into modules and classes under main Module::ViralSeq
+
 ## Development
 
 Bug reports and pull requests are welcome on GitHub at https://github.com/ViralSeq/viral_seq. This project is intended to be a safe, welcoming space for collaboration, and contributors are expected to adhere to the [Contributor Covenant](http://contributor-covenant.org) code of conduct.

data/lib/viral_seq/Integer.rb

@@ -0,0 +1,16 @@
+# additional functions for Class::Integer
+
+class Integer
+  # factorial method for an Integer
+  # @return [Integer] factorial for given Integer
+  # @example factorial for 5
+  #   !5
+  #   => 120
+  def !
+    if self == 0
+      return 1
+    else
+      (1..self).inject(:*)
+    end
+  end
+end

data/lib/viral_seq/constant.rb

@@ -0,0 +1,7 @@
+module ViralSeq
+  
+  # array for all amino acid one letter abbreviations
+
+  AMINO_ACID_LIST = ["A", "C", "D", "E", "F", "G", "H", "I", "K", "L", "M", "N", "P", "Q", "R", "S", "T", "V", "W", "Y", "*"]
+
+end

data/lib/viral_seq/enumerable.rb

@@ -0,0 +1,132 @@
+# additional statistic/math functions to Module::Enumerable
+# @example median number
+#   array = [1,2,3,4,5,6,7,8,9,10]
+#   array.median
+#   => 5.5
+# @example sum
+#   array = [1,2,3,4,5,6,7,8,9,10]
+#   array.sum
+#   => 55
+# @example average number (mean)
+#   array = [1,2,3,4,5,6,7,8,9,10]
+#   array.mean
+#   => 5.5
+# @example sample variance
+#   array = [1,2,3,4,5,6,7,8,9,10]
+#   array.sample_variance
+#   => 9.166666666666666
+# @example standard deviation
+#   array = [1,2,3,4,5,6,7,8,9,10]
+#   array.stdev
+#   => 3.0276503540974917
+# @example upper quartile
+#   array = [1,2,3,4,5,6,7,8,9,10]
+#   array.upper_quartile
+#   => 7.5
+# @example lower_quartile
+#   array = [1,2,3,4,5,6,7,8,9,10]
+#   array.lower_quartile
+#   => 3.5
+# @example count frequency of elements in an array
+#   array = %w{cat dog monkey cat cat cat monkey}
+#   array.count_freq
+#   => {"cat"=>4, "dog"=>1, "monkey"=>2}
+# @example count frequency as percentage of elements in an array
+#   array = %w{cat dog monkey cat cat cat monkey}
+#   array.count_freq2
+#   => {"cat"=>0.57, "dog"=>0.14, "monkey"=>0.29}
+module Enumerable
+
+  # generate median number
+  # @return [Numeric] median number
+  def median
+    len = self.length
+    sorted = self.sort
+    len % 2 == 1 ? sorted[len/2] : (sorted[len/2 - 1] + sorted[len/2]).to_f / 2
+  end
+
+  # generate summed value
+  # @return [Numeric] summed value
+  def sum
+     self.inject(0){|accum, i| accum + i }
+  end
+
+  # generate mean number
+  # @return [Float] mean value
+  def mean
+    self.sum/self.length.to_f
+  end
+
+  # generate sample variance
+  # @return [Float] sample variance
+  def sample_variance
+    m = self.mean
+    sum = self.inject(0){|accum, i| accum + (i-m)**2 }
+    sum/(self.length - 1).to_f
+  end
+
+  # generate standard deviation
+  # @return [Float] standard deviation
+  def stdev
+    return Math.sqrt(self.sample_variance)
+  end
+
+  # generate upper quartile value
+  # @return [Numeric] upper quartile value
+  def upper_quartile
+    return nil if self.empty?
+    sorted_array = self.sort
+    u = (0.25*(3*sorted_array.length))
+    if (u-u.truncate).is_a?(Integer)
+      return sorted_array[(u-u.truncate)-1]
+    else
+      sample = sorted_array[u.truncate.abs-1]
+      sample1 = sorted_array[(u.truncate.abs)]
+      return sample+((sample1-sample)*(u-u.truncate))
+    end
+  end
+
+  # generate lower quartile value
+  # @return [Numeric] lower quartile value
+  def lower_quartile
+    return nil if self.empty?
+    sorted_array = self.sort
+    u = 0.25*sorted_array.length + 1
+    if (u-u.truncate).is_a?(Integer)
+      return sorted_array[(u-u.truncate)-1]
+    else
+      sample = sorted_array[u.truncate.abs-1]
+      sample1 = sorted_array[(u.truncate.abs)]
+      return sample+((sample1-sample)*(u-u.truncate))
+    end
+  end
+
+  # tabulate elements and frequencies of an Enumerable
+  # return [Hash] return a hash of :element => :freq_count
+
+  def count_freq
+    hash = Hash.new(0)
+    self.each do |element|
+      hash[element] +=1
+    end
+    return hash
+  end
+
+  # tabulate elements and frequencies (as percentage) of an Enumerable {
+  # @param decimal [Integer] decimals of frequency
+  # return [Hash] return a hash of :element => :percentage
+
+  def count_freq2(decimal = 2)
+    hash1 = Hash.new(0)
+    self.each do |element|
+      hash1[element] += 1
+    end
+    total_elements = self.size
+    hash2 = Hash.new(0)
+    hash1.each do |key,value|
+      hash2[key] = (value/total_elements.to_f).round(decimal)
+    end
+    return hash2
+  end
+
+end

data/lib/viral_seq/hash.rb

@@ -0,0 +1,45 @@
+# addition methods for Class::Hash required for ViralSeq
+
+class Hash
+
+  # subtract one hash (h2) from the other (h1) if the keys are identical
+  # @param other_hash [Hash] the hash that needs to substracted from the hash before the method
+  # @return [Hash] hash after substraction
+  # @example substract h2 from h1 if the keys match
+  #   h1 = {"Cat" => 100, "Dog" => 5, "Bird" => 2, "Snake" => 10}
+  #   h2 = {"Cat" => 100, "Dog" => 5, "Bison" => 30}
+  #   h1.difference(h2)
+  #   => {"Bird" => 2, "Snake" => 10}
+
+  def difference(other_hash)
+    reject do |k,_v|
+      other_hash.has_key? k
+    end
+  end
+
+  # return a new hash with the unique values of input hash as keys,
+  # and the keys of the unique values of input hash in an array as values of the new hash
+  # @return [Hash] a new hash of :uniq_value_of_orginial_hash => :array_of_keys
+  # @example
+  #   hash = {1=>"A", 2=>"A", 3=>"C", 4=>"C", 5=>"T"}
+  #   hash.uniq_hash
+  #   => {"A"=>[1, 2], "C"=>[3, 4], "T"=>[5]}
+
+  def uniq_hash
+    uniq_values = self.values.uniq
+    out_hash = {}
+    uniq_values.each do |uniq_va|
+      self.each do |k,v|
+        if v == uniq_va
+          if out_hash[uniq_va]
+            out_hash[uniq_va] << k
+          else
+            out_hash[uniq_va] = []
+            out_hash[uniq_va] << k
+          end
+        end
+      end
+    end
+    return out_hash
+  end
+end

data/lib/viral_seq/hivdr.rb

@@ -0,0 +1,454 @@
+
+module ViralSeq
+  class SeqHash
+
+    # functions to identify SDRMs from a ViralSeq::SeqHash object at HIV PR region.
+    #   works for MPID-DR protocol (dx.doi.org/10.17504/protocols.io.useewbe)
+    #   PR codon 1-99
+    # @param cutoff [Integer] cut-off for minimal abundance of a mutation to be called as valid mutation,
+    #   can be obtained using ViralSeq::SeqHash#poisson_minority_cutoff function
+    # @return [Array] three elements `[point_mutation_list, linkage_list, report_list]`
+    #
+    #   # point_mutation_list: two demensional array for the following information,
+    #     # [region,tcs_number,position,wildtype,mutation,count,%,CI_low,CI_high,label]
+    #   # linkage_list: two demensional array for the following information,
+    #     # [region,tcs_number,linkage,count,%,CI_low,CI_high,label]
+    #   # report_list: two demensional array for the following information,
+    #     # [position,codon,tcs_number,A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y,*]
+    # @example identify SDRMs from a FASTA sequence file of HIV PR sequences obtained after MPID-DR sequencing
+    #   my_seqhash = ViralSeq::SeqHash.fa('spec/sample_files/sample_dr_sequences/pr.fasta')
+    #   p_cut_off = my_seqhash.pm
+    #   pr_sdrm = my_seqhash.sdrm_hiv_pr(p_cut_off)
+    #   puts "region,tcs_number,position,wildtype,mutation,count,%,CI_low,CI_high,label"; pr_sdrm[0].each {|n| puts n.join(',')}
+    #   => region,tcs_number,position,wildtype,mutation,count,%,CI_low,CI_high,label
+    #   => PR,396,30,D,N,247,0.62374,0.57398,0.67163,
+    #   => PR,396,50,I,V,1,0.00253,6.0e-05,0.01399,*
+    #   => PR,396,88,N,D,246,0.62121,0.57141,0.66919,
+    #
+    #   puts "region,tcs_number,linkage,count,%,CI_low,CI_high,label"; pr_sdrm[1].each {|n| puts n.join(',')}
+    #   => region,tcs_number,linkage,count,%,CI_low,CI_high,label
+    #   => PR,396,D30N+N88D,245,0.61869,0.56884,0.66674,
+    #   => PR,396,WT,149,0.37626,0.32837,0.42602,
+    #   => PR,396,D30N,1,0.00253,6.0e-05,0.01399,*
+    #   => PR,396,D30N+I50V+N88D,1,0.00253,6.0e-05,0.01399,*
+    #
+    #   puts "position,codon,tcs_number," + ViralSeq::AMINO_ACID_LIST.join(","); pr_sdrm[2].each {|n|puts n.join(",")}
+    #   => position,codon,tcs_number,A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y,*
+    #   => PR,1,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,2,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,3,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,4,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+    #   => PR,5,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,6,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0
+    #   => PR,7,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,8,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,9,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,10,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,11,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+    #   => PR,12,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,37.8788,62.1212,0.0,0.0,0.0,0.0
+    #   => PR,13,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,38.1313,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,61.8687,0.0,0.0,0.0
+    #   => PR,14,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,15,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.3737,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,37.6263,0.0,0.0,0.0
+    #   => PR,16,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,17,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,18,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.4949,0.5051,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,19,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,20,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,21,396,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,22,396,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,23,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,24,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,25,396,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,26,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+    #   => PR,27,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,28,396,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,29,396,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,30,396,0.0,0.0,37.6263,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.3737,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,31,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+    #   => PR,32,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+    #   => PR,33,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0
+    #   => PR,34,396,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,35,396,0.0,0.0,62.1212,37.6263,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,36,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0
+    #   => PR,37,396,0.0,0.0,37.8788,61.8687,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,38,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,39,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.4949,0.0,0.0,0.5051,0.0,0.0,0.0,0.0,0.0
+    #   => PR,40,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,41,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,37.8788,0.0,0.0,0.0,0.0,0.0,62.1212,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,42,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0
+    #   => PR,43,396,0.0,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,44,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,45,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,46,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,47,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,48,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,49,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,50,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0
+    #   => PR,51,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,52,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,53,396,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,54,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,55,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,56,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+    #   => PR,57,396,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0,99.4949,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,58,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,59,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0
+    #   => PR,60,396,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,61,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,62,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,63,396,0.0,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,37.8788,0.0,0.0,61.8687,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,64,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.1212,0.0,37.8788,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,65,396,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,66,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,67,396,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,68,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,69,396,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,70,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,71,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.1212,37.8788,0.0,0.0,0.0
+    #   => PR,72,396,0.0,0.0,0.0,37.8788,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.1212,0.0,0.0,0.0,0.0
+    #   => PR,73,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,74,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+    #   => PR,75,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+    #   => PR,76,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,77,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,78,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,79,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,80,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+    #   => PR,81,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,82,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+    #   => PR,83,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.4949,0.0,0.0,0.0,0.5051,0.0,0.0,0.0,0.0,0.0
+    #   => PR,84,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,85,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,86,396,0.0,0.0,0.0,0.5051,0.0,99.4949,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,87,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,88,396,0.0,0.0,62.1212,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,37.8788,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,89,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,90,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,91,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+    #   => PR,92,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,93,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,94,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,95,396,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,96,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+    #   => PR,97,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+    #   => PR,98,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0
+    #   => PR,99,396,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+
+    def sdrm_hiv_pr(cutoff = 0)
+      sequences = self.dna_hash
+      region = "PR"
+      rf_label = 0
+      start_codon_number = 1
+      n_seq = sequences.size
+      mut = {}
+      mut_com = []
+      aa = {}
+      point_mutation_list = []
+      sequences.each do |name,seq|
+        s = ViralSeq::Sequence.new(name,seq)
+        s.translate(rf_label)
+        aa[name] = s.aa_string
+        record = s.sdrm(:hiv_pr)
+        mut_com << record
+        record.each do |position,mutation|
+          if mut[position]
+            mut[position][1] << mutation[1]
+          else
+            mut[position] = [mutation[0],[]]
+            mut[position][1] << mutation[1]
+          end
+        end
+      end
+      mut.each do |position,mutation|
+        wt = mutation[0]
+        mut_list = mutation[1]
+        count_mut_list = mut_list.count_freq
+        count_mut_list.each do |m,number|
+          ci = ViralSeq::Math::BinomCI.new(number, n_seq)
+          label = number < cutoff ? "*" : ""
+          point_mutation_list << [region, n_seq, position, wt, m, number, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label]
+        end
+      end
+      point_mutation_list.sort_by! {|record| record[2]}
+
+      link = mut_com.count_freq
+      link2 = {}
+      link.each do |k,v|
+        pattern = []
+        if k.size == 0
+          pattern = ['WT']
+        else
+          k.each do |p,m|
+            pattern << (m[0] + p.to_s + m[1])
+          end
+        end
+        link2[pattern.join("+")] = v
+      end
+      linkage_list = []
+      link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v|
+        ci = ViralSeq::Math::BinomCI.new(v, n_seq)
+        label = v < cutoff ? "*" : ""
+        linkage_list << [region, n_seq, k, v, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label]
+      end
+
+      report_list = []
+
+      div_aa = {}
+      aa_start = start_codon_number
+
+      aa_size = aa.values[0].size - 1
+
+      (0..aa_size).to_a.each do |p|
+        aas = []
+        aa.values.each do |r1|
+          aas << r1[p]
+        end
+        count_aas = aas.count_freq
+        div_aa[aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h
+        aa_start += 1
+      end
+
+      div_aa.each do |k,v|
+        record = [region, k, n_seq]
+        ViralSeq::AMINO_ACID_LIST.each do |amino_acid|
+          aa_count = v[amino_acid]
+          record << (aa_count.to_f/n_seq*100).round(4)
+        end
+        report_list << record
+      end
+
+      return [point_mutation_list, linkage_list, report_list]
+    end
+
+
+    # functions to identify SDRMs from a ViralSeq::SeqHash object at HIV RT region.
+    #   works for MPID-DR protocol (dx.doi.org/10.17504/protocols.io.useewbe)
+    #   RT codon 34-122, 152-236, two regions are linked
+    # @param (see #sdrm_hiv_pr)
+    # @return (see #sdrm_hiv_pr)
+
+    def sdrm_hiv_rt(cutoff = 0)
+      sequences = self.dna_hash
+      region = "RT"
+      rf_label = 1
+      start_codon_number = 34
+      gap = "AGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCAC"
+
+      n_seq = sequences.size
+      mut_nrti = {}
+      mut_nnrti = {}
+      mut_com = []
+      r1_aa = {}
+      r2_aa = {}
+      point_mutation_list = []
+      sequences.each do |name,seq|
+        r1 = seq[0,267]
+        r2 = seq[267..-1]
+        seq = r1 + gap + r2
+        s = ViralSeq::Sequence.new(name,seq)
+        s.translate(rf_label)
+
+        r1_aa[name] = s.aa_string[0,89]
+        r2_aa[name] = s.aa_string[-85..-1]
+        nrti = s.sdrm(:nrti, start_codon_number)
+        nnrti = s.sdrm(:nnrti, start_codon_number)
+        mut_com << (nrti.merge(nnrti))
+
+        nrti.each do |position,mutation|
+          if mut_nrti[position]
+            mut_nrti[position][1] << mutation[1]
+          else
+            mut_nrti[position] = [mutation[0],[]]
+            mut_nrti[position][1] << mutation[1]
+          end
+        end
+        nnrti.each do |position,mutation|
+          if mut_nnrti[position]
+            mut_nnrti[position][1] << mutation[1]
+          else
+            mut_nnrti[position] = [mutation[0],[]]
+            mut_nnrti[position][1] << mutation[1]
+          end
+        end
+      end
+
+      mut_nrti.each do |position,mutation|
+        wt = mutation[0]
+        mut_list = mutation[1]
+        count_mut_list = mut_list.count_freq
+        count_mut_list.each do |m,number|
+          ci = ViralSeq::Math::BinomCI.new(number, n_seq)
+          label = number < cutoff ? "*" : ""
+          point_mutation_list << ["NRTI", n_seq, position, wt, m, number, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label]
+        end
+      end
+
+      mut_nnrti.each do |position,mutation|
+        wt = mutation[0]
+        mut_list = mutation[1]
+        count_mut_list = mut_list.count_freq
+        count_mut_list.each do |m,number|
+          ci = ViralSeq::Math::BinomCI.new(number, n_seq)
+          label = number < cutoff ? "*" : ""
+          point_mutation_list << ["NNRTI", n_seq, position, wt, m, number, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label]
+        end
+      end
+
+      point_mutation_list.sort_by! {|record| record[2]}
+
+      link = mut_com.count_freq
+      link2 = {}
+      link.each do |k,v|
+        pattern = []
+        if k.size == 0
+          pattern = ['WT']
+        else
+          k.each do |p,m|
+            pattern << (m[0] + p.to_s + m[1])
+          end
+        end
+        link2[pattern.join("+")] = v
+      end
+      linkage_list = []
+      link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v|
+        ci = ViralSeq::Math::BinomCI.new(v, n_seq)
+        label = v < cutoff ? "*" : ""
+        linkage_list << [region, n_seq, k, v, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label]
+      end
+
+      report_list = []
+
+      div_aa = {}
+      r1_aa_start = 34
+      r2_aa_start = 152
+
+      r1_aa_size = r1_aa.values[0].size - 1
+      r2_aa_size = r2_aa.values[0].size - 1
+
+      (0..r1_aa_size).to_a.each do |p|
+        aas = []
+        r1_aa.values.each do |r1|
+          aas << r1[p]
+        end
+        count_aas = aas.count_freq
+        div_aa[r1_aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h
+        r1_aa_start += 1
+      end
+
+      (0..r2_aa_size).to_a.each do |p|
+        aas = []
+        r2_aa.values.each do |r1|
+          aas << r1[p]
+        end
+        count_aas = aas.count_freq
+        div_aa[r2_aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h
+        r2_aa_start += 1
+      end
+
+      div_aa.each do |k,v|
+        record = [region, k, n_seq]
+        ViralSeq::AMINO_ACID_LIST.each do |amino_acid|
+          aa_count = v[amino_acid]
+          record << (aa_count.to_f/n_seq*100).round(4)
+        end
+        report_list << record
+      end
+
+      return [point_mutation_list, linkage_list, report_list]
+    end
+
+    # functions to identify SDRMs from a ViralSeq::SeqHash object at HIV IN region.
+    #   works for MPID-DR protocol (dx.doi.org/10.17504/protocols.io.useewbe)
+    #   IN codon 53-174
+    # @param (see #sdrm_hiv_pr)
+    # @return (see #sdrm_hiv_pr)
+
+    def sdrm_hiv_in(cutoff = 0)
+      sequences = self.dna_hash
+      region = "IN"
+      rf_label = 2
+      start_codon_number = 53
+      n_seq = sequences.size
+      mut = {}
+      mut_com = []
+      aa = {}
+      point_mutation_list = []
+      sequences.each do |name,seq|
+        s = ViralSeq::Sequence.new(name,seq)
+        s.translate(rf_label)
+        aa[name] = s.aa_string
+        record = s.sdrm(:hiv_in, start_codon_number)
+        mut_com << record
+        record.each do |position,mutation|
+          if mut[position]
+            mut[position][1] << mutation[1]
+          else
+            mut[position] = [mutation[0],[]]
+            mut[position][1] << mutation[1]
+          end
+        end
+      end
+
+      mut.each do |position,mutation|
+        wt = mutation[0]
+        mut_list = mutation[1]
+        count_mut_list = mut_list.count_freq
+        count_mut_list.each do |m,number|
+          ci = ViralSeq::Math::BinomCI.new(number, n_seq)
+          label = number < cutoff ? "*" : ""
+          point_mutation_list << [region, n_seq, position, wt, m, number, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label]
+        end
+      end
+      point_mutation_list.sort_by! {|record| record[2]}
+
+      link = mut_com.count_freq
+      link2 = {}
+      link.each do |k,v|
+        pattern = []
+        if k.size == 0
+          pattern = ['WT']
+        else
+          k.each do |p,m|
+            pattern << (m[0] + p.to_s + m[1])
+          end
+        end
+        link2[pattern.join("+")] = v
+      end
+      linkage_list = []
+      link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v|
+        ci = ViralSeq::Math::BinomCI.new(v, n_seq)
+        label = v < cutoff ? "*" : ""
+        linkage_list << [region, n_seq, k, v, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label]
+      end
+
+      report_list = []
+
+      div_aa = {}
+      aa_start = start_codon_number
+
+      aa_size = aa.values[0].size - 1
+
+      (0..aa_size).to_a.each do |p|
+        aas = []
+        aa.values.each do |r1|
+          aas << r1[p]
+        end
+        count_aas = aas.count_freq
+        div_aa[aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h
+        aa_start += 1
+      end
+
+      div_aa.each do |k,v|
+        record = [region, k, n_seq]
+        ViralSeq::AMINO_ACID_LIST.each do |amino_acid|
+          aa_count = v[amino_acid]
+          record << (aa_count.to_f/n_seq*100).round(4)
+        end
+        report_list << record
+      end
+
+      return [point_mutation_list, linkage_list, report_list]
+    end
+
+  end # end of ViralSeq::SeqHash
+end # end of ViralSeq