minimap2 0.2.31.0 → 1.2.31.0

checksums.yaml

@@ -1,7 +1,7 @@
 ---
 SHA256:
-  metadata.gz: b27519808e7302696fd897b42041bc6f6f11ac114bc9654a91c07c59f5284813
-  data.tar.gz: 8adb8dd6b933029ce21b66269750dc1017af4c5e3f292fb7f3da65c7bd25eae7
+  metadata.gz: 66111ad941edb14875a0f3c66f8ac1f5cbef18182bb96cb2a363f8ec29e6e817
+  data.tar.gz: 2ce71684a6a25196f7735252888cbdc1ff66674829edbb72d492184ecc171510
 SHA512:
-  metadata.gz: 30ac518def61ad07b388acb1a20dd4857cd7de124c3ca7eb942049834a6927763e2c31e8f9da12457eae786fad92a8153a28cb711f027124521721b7147eb4b0
-  data.tar.gz: 9cf1e73fb89b42a55630b049a9dd0a8612c68910f3b02227c2a19a2b0b57963497f7dce1e78dc0f13eafc69967f21eb2e5526808c4bda4d02f9f1bc6a57a57ef
+  metadata.gz: 6f708837128825a21efe2428ccef35f985c6de313d7dc2a669ef45b6ba17873a3672859fcc72c11f2dfd12af26686f5e5909f952a99fb7a519a37749d59798c4
+  data.tar.gz: '0083cf367e4bfd1c9eeeeea626289d97d064cc69efd47e1bcb50fddbe13ffece5f5d8b4f540926daaaa3224eed225227cd2a07b367d310bbf34a906c164dafb3'

data/README.md

@@ -11,9 +11,9 @@
 
 ## Installation
 
-ruby-minimap2 bundles the Minimap2 C source code and builds it automatically during installation.
+ruby-minimap2 bundles the Minimap2 C source code and builds a native extension during installation.
 
-Just install the gem. Works on Linux, macOS, and Windows.
+Ruby 3.3 or later is required. Works on Linux, macOS, and Windows.
 
 ```
 gem install minimap2
@@ -41,30 +41,39 @@ ruby -r minimap2 -e 'Minimap2.execute("--version")'
 ```ruby
 require "minimap2"
 
-aligner = Minimap2::Aligner.new("ext/minimap2/test/MT-human.fa")
-seq     = aligner.seq("MT_human", 100, 200)
-hits    = aligner.align(seq, cs: true, ds: true)
+reference = <<~DNA.delete("\n")
+  GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGC
+  GATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTAT
+  CGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACA
+  ATTGAATGTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTC
+DNA
+
+aligner = Minimap2::Aligner.new(seq: reference)
+query   = reference[50, 200]
+hits    = aligner.align(query, name: "query", cs: true, ds: true)
 pp hits
 ```
 
 ```
 [#<Minimap2::Alignment:0x000055bbfde2d128
-  @blen=100,
-  @cigar=[[100, 0]],
-  @cigar_str="100M",
-  @cs=":100",
-  @ctg="MT_human",
-  @ctg_len=16569,
-  @ds=":100",
+  @blen=200,
+  @cigar=[[200, 0]],
+  @cigar_str="200M",
+  @cs=":200",
+  @ctg="N/A",
+  @ctg_len=320,
+  @ds=":200",
   @mapq=60,
-  @md="",
-  @mlen=100,
+  @md=nil,
+  @mlen=200,
   @nm=0,
   @primary=1,
-  @q_en=100,
+  @q_en=200,
   @q_st=0,
-  @r_en=200,
-  @r_st=100,
+  @qlen=200,
+  @qname="query",
+  @r_en=250,
+  @r_st=50,
   @read_num=1,
   @strand=1,
   @trans_strand=0>]
@@ -77,19 +86,25 @@ pp hits
   - fastx_read                  Read fasta/fastq file.
   - revcomp                     Reverse complement sequence.
   - execute                     Calls the main function of Minimap2 with arguments. `Minimap2.execute("--version")`
+  - verbose                     Returns the Minimap2 verbosity level.
+  - verbose=                    Sets the Minimap2 verbosity level.
 
   * Aligner class
-    * attributes
-      - index                   Returns the value of attribute index.
-      - idx_opt                 Returns the value of attribute idx_opt.
-      - map_opt                 Returns the value of attribute map_opt.
     * methods
-      - new(path, preset: nil)  Create a new aligner. (presets: sr, map-pb, map-out, map-hifi, splice, asm5, etc.)
+      - new(path, preset: nil)  Create a new aligner. (presets: sr, map-pb, map-ont, map-hifi, splice, asm5, etc.)
       - align                   Maps and returns alignments.
       - seq                     Retrieve a subsequence from the index.
+      - k                       Returns the minimizer k-mer length.
+      - w                       Returns the minimizer window size.
+      - n_seq                   Returns the number of sequences in the index.
+      - seq_names               Returns sequence names in the index.
+      - index?                  Returns whether the aligner has a live index.
+      - free_index              Releases the index.
 
   * Alignment class
     * attributes
+      - qname                   Returns the query sequence name.
+      - qlen                    Returns the query sequence length.
       - ctg                     Returns name of the reference sequence the query is mapped to.
       - ctg_len                 Returns total length of the reference sequence.
       - r_st                    Returns start positions on the reference.
@@ -105,47 +120,22 @@ pp hits
       - mapq                    Returns mapping quality.
       - cigar                   Returns CIGAR returned as an array of shape (n_cigar,2). The two numbers give the length and the operator of each CIGAR operation.
       - read_num                Returns read number that the alignment corresponds to; 1 for the first read and 2 for the second read.
-      - cs                      Returns the cs tag.
-      - ds                      Returns the ds tag.
-      - md                      Returns the MD tag as in the SAM format. It is an empty string unless the md argument is applied when calling Aligner#align.
+      - cs                      Returns the cs tag, or nil unless requested.
+      - ds                      Returns the ds tag, or nil unless requested.
+      - md                      Returns the MD tag, or nil unless requested.
       - cigar_str               Returns CIGAR string.
     * methods
       - to_h                    Convert Alignment to hash.
-      - to_s                    Convert to the PAF format without the QueryName and QueryLength columns.
-
-  ## FFI module
-    * IdxOpt class              Indexing options.
-    * MapOpt class              Mapping options.
+      - to_s                    Convert to the PAF format.
 ```
 
 - API is based on [Mappy](https://github.com/lh3/minimap2/tree/master/python), the official Python binding for Minimap2.
 - `Aligner#map` has been changed to `align`, because `map` means iterator in Ruby.
+- Calls on the same Aligner are thread-safe and serialized. Different Aligner instances can run concurrently.
+- Multipart indexes are supported, but primary alignments and mapping quality are calculated independently for each part.
+- Sequence data uses ASCII-8BIT. Names read from an index use UTF-8.
 - See [documentation](https://kojix2.github.io/ruby-minimap2/) for details.
 
-<details>
-<summary><b>C Structures and Functions</b></summary>
-
-### FFI
-
-- Ruby-Minimap2 is built on top of [Ruby-FFI](https://github.com/ffi/ffi).
-  - Native C functions can be called from the `Minimap2::FFI` module.
-  - Native C structure members can be accessed.
-  - Bitfields are supported by [ffi-bitfield](https://github.com/kojix2/ffi-bitfield) gems.
-
-```ruby
-aligner.idx_opt.members
-# => [:k, :w, :flag, :bucket_bits, :mini_batch_size, :batch_size]
-aligner.kds_opt.values
-# => [15, 10, 0, 14, 50000000, 9223372036854775807]
-aligner.idx_opt[:k]
-# => 15
-aligner.idx_opt[:k] = 14
-aligner.idx_opt[:k]
-# => 14
-```
-
-</details>
-
 ## Contributing
 
 <details>
@@ -161,21 +151,14 @@ git clone --recursive https://github.com/kojix2/ruby-minimap2
 # git submodule update -i
 ```
 
-Build Minimap2 and Mappy.
+Build the native extension.
 
 ```sh
 cd ruby-minimap2
-bundle install # Install dependent packages including Ruby-FFI
+bundle install
 bundle exec rake minimap2:build
 ```
 
-A shared library will be created in the vendor directory.
-
-```
-└── vendor
-   └── libminimap2.so
-```
-
 Run tests.
 
 ```
@@ -187,7 +170,7 @@ Release a Gem.
 ```
 bundle exec rake minimap2:cleanall
 bundle exec rake build
-ls -l pkg # Check the size of the Gem and make sure it does not contain any unused code such as shared libraries or lib/simde.
+ls -l pkg # Check the size of the Gem.
 bundle exec rake release
 ```
 

data/ext/ruby_minimap2/extconf.rb

@@ -0,0 +1,47 @@
+# frozen_string_literal: true
+
+require "mkmf"
+require "fileutils"
+require "rbconfig"
+require "shellwords"
+
+source_dir = File.expand_path("../minimap2", __dir__)
+build_dir = File.expand_path("build/minimap2", Dir.pwd)
+
+abort "minimap2 sources are missing; initialize the git submodule" unless File.file?(File.join(source_dir, "minimap.h"))
+abort "zlib is required to build ruby-minimap2" unless have_library("z", "gzopen")
+have_func("log") || have_library("m", "log")
+if !(RbConfig::CONFIG.fetch("host_os") =~ /mswin/) && !(have_func("pthread_create") || have_library("pthread",
+                                                                                                    "pthread_create"))
+  abort "pthread is required to build ruby-minimap2"
+end
+
+FileUtils.rm_rf(build_dir)
+FileUtils.mkdir_p(build_dir)
+FileUtils.cp_r(Dir.glob(File.join(source_dir, "*")), build_dir)
+
+host_cpu = RbConfig::CONFIG.fetch("host_cpu")
+cflags = %w[-O2 -fPIC]
+cflags.concat(Shellwords.split(RbConfig::CONFIG["ARCH_FLAG"].to_s))
+make_args = ["libminimap2.a", "CC=#{RbConfig::CONFIG.fetch('CC')}"]
+make_args << "AR=#{RbConfig::CONFIG['AR']}" unless RbConfig::CONFIG["AR"].to_s.empty?
+
+case host_cpu
+when /arm64|aarch64/
+  make_args.concat(["aarch64=1", "INCLUDES=-Isse2neon"])
+  cflags.concat(%w[-D_FILE_OFFSET_BITS=64 -fsigned-char])
+when /arm/
+  make_args.concat(["arm_neon=1", "INCLUDES=-Isse2neon"])
+  cflags.concat(%w[-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char])
+end
+make_args << "CFLAGS=#{cflags.join(' ')}"
+
+Dir.chdir(build_dir) do
+  abort "failed to build bundled minimap2" unless system(RbConfig::CONFIG.fetch("MAKE", "make"), *make_args)
+end
+
+$INCFLAGS << " -I#{build_dir.quote}"
+$LOCAL_LIBS << " #{File.join(build_dir, 'libminimap2.a').quote}"
+$defs << "-DRUBY_MINIMAP2_TESTING" if enable_config("testing", false)
+
+create_makefile("minimap2/minimap2_ext")

data/ext/ruby_minimap2/native_main.c

@@ -0,0 +1,15 @@
+#include <stdlib.h>
+
+#ifdef __clang__
+#pragma clang diagnostic push
+#pragma clang diagnostic ignored "-Wshorten-64-to-32"
+#pragma clang diagnostic ignored "-Wincompatible-pointer-types-discards-qualifiers"
+#endif
+
+#define main mm2_embedded_main
+#define exit(status) return (status)
+#include "build/minimap2/main.c"
+
+#ifdef __clang__
+#pragma clang diagnostic pop
+#endif