genomer-plugin-view 0.0.4 → 0.0.5

data/README.md

@@ -0,0 +1,90 @@
+![View: the blossom of a genome assembly](http://genomer.s3.amazonaws.com/icon/view/view.jpg)
+
+## About
+
+View is a plugin for the [genomer][] tool for genome projects. This plugin can
+be used to generate the files required to upload a genome project. The files
+generated includes sequence and annotation files. Each of the possible file
+formats is documented with a [manual page][man].
+
+[genomer]: https://github.com/michaelbarton/genomer
+[man]: https://github.com/michaelbarton/genomer-plugin-view/tree/master/man
+
+## Usage
+
+The following examples are taken from the [Pseudomonas fluorescens R124][r124]
+genome project. These examples can be run by downloading this project and
+running bundle install.
+
+[r124]: https://github.com/michaelbarton/chromosome-pfluorescens-r124-genome
+
+The following command can be used to generate a fasta file with associated
+metadata:
+
+    genomer view fasta                                 \
+      --identifier='PRJNA68653'                        \
+      --organism='Pseudomonas fluorescens'             \
+      --strain='R124'                                  \
+      --gcode='11'                                     \
+      --topology='circular'                            \
+      --isolation-source='Orthoquartzite Cave Surface' \
+      --collection-date='17-Oct-2007'                  \
+      --completeness='Complete'                        \
+
+    >PRJNA68653 [organism=Pseudomonas fluorescens] [strain=R124] [gcode=11] ...
+    TGTTACCTGGTTCGTCCACAACGGGCCGGAATGGCCCCCGTTTTAAGAGACCGGGGATTCTAGAGAAAGC
+    AAGCCTTCAGGTCAATTTCCAACCAACGTTTCCTTATAAATAGATATCTGGAGCATCCAGAACCAAGACC
+    TTGCCTGCCAAACATAAAAATAAAGAAGGGAATTATTTAAAGCTTTTCTGTAAAGCTTATAAAAGCTAGG
+    GCGACAGTCTCTGTGGATAACCATGTTCAGCCCTTGTCTGGCTTGATGTACAGAGAATGACAACTACAGT
+    GGAAAACCGTGGTCAGCCTGTGCTGCGCTGTCGGATAACCTGTGTGTGGAACCGTCAGTTATCCACAGGC
+    AGGTTATCCACCGAGTTCCACCCCCAGTTGTCCAGTGCCCTCAGAGGCGGTTATCCACAGAGCTTATTCA
+    CACACCGTTGGTCGCCTTTTTACCGGTTAACGCATTGATTAATCATGGTCACCACACAACCTGCATGTGG
+    ...
+
+The following can be used to generate an annotation table suitable for
+submission to GenBank using tbl2asn.
+
+    genomer view table					                      \
+      --identifier=PRJNA68653                         \
+      --reset_locus_numbering=52                      \
+      --prefix='I1A_'                                 \
+      --generate_encoded_features='gnl|BartonUAkron|' \
+
+    >Feature	PRJNA68653	annotation_table
+    562	2076	gene
+          locus_tag	I1A_000052
+          gene	dnaA
+    562	2076	CDS
+          protein_id	gnl|BartonUAkron|I1A_000052
+          product	DnaA
+          function	chromosomal replication initiator protein
+    2116	3219	gene
+          locus_tag	I1A_000053
+    2116	3219	CDS
+          protein_id	gnl|BartonUAkron|I1A_000053
+          product	DNA polymerase III, beta subunit
+    ...
+
+## Installation
+
+Add this line to your genomer projects's Gemfile:
+
+    gem 'genomer-plugin-view'
+
+And then execute in the project directory:
+
+    $ bundle
+
+Run the `help` command and the summary plugin should be available:
+
+    $ genomer help
+    $ genomer man view
+
+## Copyright
+
+Genomer copyright (c) 2010 by Michael Barton. Genomer is licensed under the MIT
+license. See LICENSE.txt for further details. The Star of Bethlehem image is
+used under a Creative Commons Generic 2.0 Licence. The original can be [found
+on flickr.][flickr]
+
+[flickr]: http://www.flickr.com/photos/mamjodh/4547707941/

data/features/agp/{generation.feature → core.feature}

@@ -3,10 +3,17 @@ Feature: Producing an agp view of a scaffold
   A user can use the "agp" command
   to generate an agp file of the scaffold
 
+  @disable-bundler
+  Scenario: Getting the man page for the scaffold agp view
+    Given I create a new genomer project
+     When I run `genomer man view agp`
+     Then the exit status should be 0
+      And the output should contain a valid man page
+      And the output should contain "GENOMER-VIEW-AGP(1)"
+
   @disable-bundler
   Scenario: A single contig scaffold
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
       """
       ---
@@ -19,10 +26,6 @@ Feature: Producing an agp view of a scaffold
       >contig00001
       ATGGC
       """
-      And I append to "Gemfile" with:
-      """
-      gem 'genomer-plugin-view', :path => '../../../'
-      """
      When I run `genomer view agp`
      Then the exit status should be 0
       And the output should contain:
@@ -33,8 +36,7 @@ Feature: Producing an agp view of a scaffold
 
   @disable-bundler
   Scenario: A two contig scaffold
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
       """
       ---
@@ -52,10 +54,6 @@ Feature: Producing an agp view of a scaffold
       >contig00002
       ATGGC
       """
-      And I append to "Gemfile" with:
-      """
-      gem 'genomer-plugin-view', :path => '../../../'
-      """
      When I run `genomer view agp`
      Then the exit status should be 0
       And the output should contain:
@@ -67,8 +65,7 @@ Feature: Producing an agp view of a scaffold
 
   @disable-bundler
   Scenario: A single contig scaffold with a gap
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
       """
       ---
@@ -81,10 +78,6 @@ Feature: Producing an agp view of a scaffold
       >contig00001
       ATGNNNGCG
       """
-      And I append to "Gemfile" with:
-      """
-      gem 'genomer-plugin-view', :path => '../../../'
-      """
      When I run `genomer view agp`
      Then the exit status should be 0
       And the output should contain:
@@ -97,8 +90,7 @@ Feature: Producing an agp view of a scaffold
 
   @disable-bundler
   Scenario: Two contigs scaffold containing gaps
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
       """
       ---
@@ -116,10 +108,6 @@ Feature: Producing an agp view of a scaffold
       >contig00002
       ANG
       """
-      And I append to "Gemfile" with:
-      """
-      gem 'genomer-plugin-view', :path => '../../../'
-      """
      When I run `genomer view agp`
      Then the exit status should be 0
       And the output should contain:
@@ -135,8 +123,7 @@ Feature: Producing an agp view of a scaffold
 
   @disable-bundler
   Scenario: Two contigs separated by an unresolved region
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
       """
       ---
@@ -157,10 +144,6 @@ Feature: Producing an agp view of a scaffold
       >contig00002
       ATGAT
       """
-      And I append to "Gemfile" with:
-      """
-      gem 'genomer-plugin-view', :path => '../../../'
-      """
      When I run `genomer view agp`
      Then the exit status should be 0
       And the output should contain:
@@ -173,8 +156,7 @@ Feature: Producing an agp view of a scaffold
 
   @disable-bundler
   Scenario: Two contigs separated by an unresolved region
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
       """
       ---
@@ -195,10 +177,6 @@ Feature: Producing an agp view of a scaffold
       >contig00002
       ATGATNNNNN
       """
-      And I append to "Gemfile" with:
-      """
-      gem 'genomer-plugin-view', :path => '../../../'
-      """
      When I run `genomer view agp`
      Then the exit status should be 0
       And the output should contain:
@@ -213,8 +191,7 @@ Feature: Producing an agp view of a scaffold
 
   @disable-bundler
   Scenario: A single contig scaffold with a gap filled with an insert
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
       """
       ---
@@ -234,10 +211,6 @@ Feature: Producing an agp view of a scaffold
       >insert00001
       TTT
       """
-      And I append to "Gemfile" with:
-      """
-      gem 'genomer-plugin-view', :path => '../../../'
-      """
      When I run `genomer view agp`
      Then the exit status should be 0
       And the output should contain:
@@ -248,8 +221,7 @@ Feature: Producing an agp view of a scaffold
 
   @disable-bundler
   Scenario: A single contig scaffold with a gap partially filled with an insert
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
       """
       ---
@@ -269,10 +241,6 @@ Feature: Producing an agp view of a scaffold
       >insert00001
       TTT
       """
-      And I append to "Gemfile" with:
-      """
-      gem 'genomer-plugin-view', :path => '../../../'
-      """
      When I run `genomer view agp`
      Then the exit status should be 0
       And the output should contain:

data/features/core.feature

@@ -0,0 +1,12 @@
+Feature: Producing different views of a genomes scaffold
+  In order to have required file formats of a genome scaffold
+  A user can use the "view" plugin
+  to generate file formats
+
+  @disable-bundler
+  Scenario: Getting the man page for the genomer view plugin
+    Given I create a new genomer project
+     When I run `genomer man view`
+     Then the exit status should be 0
+      And the output should contain a valid man page
+      And the output should contain "GENOMER-VIEW(1)"

data/features/fasta/core.feature

@@ -0,0 +1,12 @@
+Feature: Producing a fasta view of a genome scaffold
+  In order to have generate a fasta file of a genome scaffold
+  A user can use the "view fasta" plugin
+  to generate a fasta file
+
+  @disable-bundler
+  Scenario: Getting the man page for the genomer view plugin
+    Given I create a new genomer project
+     When I run `genomer man view fasta`
+     Then the exit status should be 0
+      And the output should contain a valid man page
+      And the output should contain "GENOMER-VIEW-FASTA(1)"

data/features/gff/core.feature

@@ -3,6 +3,14 @@ Feature: Producing a gff3 view of a scaffold's annotations
   A user can use the "gff" command
   to generate gff3 view of scaffold annotations
 
+  @disable-bundler
+  Scenario: Getting the man page for the scaffold gff view
+    Given I create a new genomer project
+     When I run `genomer man view gff`
+     Then the exit status should be 0
+      And the output should contain a valid man page
+      And the output should contain "GENOMER-VIEW-GFF(1)"
+
   @disable-bundler
   Scenario: A single annotation on a single contig
     Given I successfully run `genomer init project`

data/features/mappings/core.feature

@@ -3,10 +3,17 @@ Feature: Producing a map of annotations IDs
   A user can use the "mapping" command
   to generate a list of the original and updated annotations
 
+  @disable-bundler
+  Scenario: Getting the man page for the genomer view plugin
+    Given I create a new genomer project
+     When I run `genomer man view mapping`
+     Then the exit status should be 0
+      And the output should contain a valid man page
+      And the output should contain "GENOMER-VIEW-MAPPING(1)"
+
   @disable-bundler
   Scenario: Two genes with locus tag numbering reset at the scaffold origin
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
         """
         ---
@@ -24,10 +31,6 @@ Feature: Producing a map of annotations IDs
         contig1	.	gene	1	3	.	+	1	ID=gene1
         contig1	.	gene	4	6	.	+	1	ID=gene2
         """
-      And I append to "Gemfile" with:
-        """
-        gem 'genomer-plugin-view', :path => '../../../'
-        """
      When I run `genomer view mapping --reset_locus_numbering`
      Then the exit status should be 0
       And the output should contain:
@@ -38,8 +41,7 @@ Feature: Producing a map of annotations IDs
 
   @disable-bundler
   Scenario: Two genes with locus tag numbering reset at specified start value
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
         """
         ---
@@ -57,10 +59,6 @@ Feature: Producing a map of annotations IDs
         contig1	.	gene	1	3	.	+	1	ID=gene1
         contig1	.	gene	4	6	.	+	1	ID=gene2
         """
-      And I append to "Gemfile" with:
-        """
-        gem 'genomer-plugin-view', :path => '../../../'
-        """
      When I run `genomer view mapping --reset_locus_numbering=5`
      Then the exit status should be 0
       And the output should contain:
@@ -71,8 +69,7 @@ Feature: Producing a map of annotations IDs
 
   @disable-bundler
   Scenario: Four unordered genes with locus tag reset at the scaffold origin
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
         """
         ---
@@ -92,10 +89,6 @@ Feature: Producing a map of annotations IDs
         contig1	.	gene	1	3	.	+	1	ID=gene1
         contig1	.	gene	7	9	.	+	1	ID=gene3
         """
-      And I append to "Gemfile" with:
-        """
-        gem 'genomer-plugin-view', :path => '../../../'
-        """
      When I run `genomer view mapping --reset_locus_numbering`
      Then the exit status should be 0
       And the output should contain:
@@ -108,8 +101,7 @@ Feature: Producing a map of annotations IDs
 
   @disable-bundler
   Scenario: Four genes with a prefix added to the locus tags
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
         """
         ---
@@ -129,10 +121,6 @@ Feature: Producing a map of annotations IDs
         contig1	.	gene	1	3	.	+	1	ID=gene1
         contig1	.	gene	7	9	.	+	1	ID=gene3
         """
-      And I append to "Gemfile" with:
-        """
-        gem 'genomer-plugin-view', :path => '../../../'
-        """
      When I run `genomer view mapping --prefix=pre_`
      Then the exit status should be 0
       And the output should contain:
@@ -145,8 +133,7 @@ Feature: Producing a map of annotations IDs
 
   @disable-bundler
   Scenario: Four genes prefixes and locus tag reset at the scaffold origin
-    Given I successfully run `genomer init project`
-      And I cd to "project"
+    Given I create a new genomer project
       And I write to "assembly/scaffold.yml" with:
         """
         ---
@@ -166,10 +153,6 @@ Feature: Producing a map of annotations IDs
         contig1	.	gene	1	3	.	+	1	ID=gene1
         contig1	.	gene	7	9	.	+	1	ID=gene3
         """
-      And I append to "Gemfile" with:
-        """
-        gem 'genomer-plugin-view', :path => '../../../'
-        """
 	When I run `genomer view mapping --reset_locus_numbering=5 --prefix=pre_`
      Then the exit status should be 0
       And the output should contain:

data/features/support/genomer_steps.rb

@@ -0,0 +1,11 @@
+When /^I create a new genomer project$/ do
+  step 'I successfully run `genomer init project`'
+  step 'I cd to "project"'
+  step 'I append to "Gemfile" with "gem \'genomer-plugin-view\', :path =>\'../../../\'"'
+end
+
+Then /^the output should contain a valid man page$/ do
+  step 'the output should not contain "md2man/roff: raw_html not implemented"'
+  step 'the output should not contain "\<"'
+  step 'the output should not contain "\>"'
+end

data/features/table/core.feature

@@ -3,6 +3,15 @@ Feature: Producing a annotation view of a scaffold
   A user can use the "table" command
   to generate the genbank annotation table format
 
+  @disable-bundler
+  Scenario: Getting the man page for the scaffold table view
+    Given I create a new genomer project
+     When I run `genomer man view table`
+     Then the exit status should be 0
+      And the output should contain a valid man page
+      And the output should contain "GENOMER-VIEW-TABLE(1)"
+
+
   @disable-bundler
   Scenario: Generating a table file from a single annotation
     Given I successfully run `genomer init project`

data/lib/genomer-plugin-view/version.rb

@@ -1,3 +1,3 @@
 class GenomerViewPlugin
-  VERSION = "0.0.4"
+  VERSION = "0.0.5"
 end

data/man/genomer-view-agp.ronn

@@ -1,5 +1,8 @@
+# GENOMER-VIEW-AGP 1
+
+## NAME
+
 genomer-view-agp(1) -- Generate agp file views of scaffold
-==========================================================
 
 ## SYNOPSIS
 

data/man/genomer-view-fasta.ronn

@@ -0,0 +1,48 @@
+# GENOMER-VIEW-FASTA 1
+
+## NAME
+
+genomer-view-fasta(1) -- Generate fasta view of scaffold
+
+## SYNOPSIS
+
+`genomer view fasta <--contigs> [...<header-options>]`
+
+## DESCRIPTION
+
+**Genomer-view-fasta** produces an fasta file of scaffold. This format provides
+the complete scaffolded sequence of all contigs and gaps specified in the
+**scaffold.yml** file.
+
+  **--contigs**:
+
+  Instead of generating a single sequence where gaps are represented by
+  N-filled regions generate a fasta file where each contiguous region of
+  sequence is a new fasta entry. Gap regions are not included in the fasta
+  file. This option is useful if submitting an incomplete genome sequence to
+  GenBank as the contigs are require in addition to an AGP file (see
+  genomer-view-agp(1)).
+
+Additional header options can be specified. These are useful for adding
+metadata to the fasta sequence. Any combination of dashes (-) and characters
+may be used. See the example below for how this may be used.
+
+## EXAMPLES
+
+    genomer view fasta	                      				 \
+      --contigs                                        \
+      --organism='Pseudomonas fluorescens'             \
+      --strain='R124'                                  \
+      --gcode='11'                                     \
+      --isolation-source='Orthoquartzite Cave Surface' \
+      --collection-date='17-Oct-2007'                  \
+      --completeness='Complete'                        \
+
+## BUGS
+
+**Genomer-view** is written in Ruby and depends on the genomer gem. See the 
+Gemfile in the genomer-plugin-view gem install directory for version details.
+
+## COPYRIGHT
+
+**Genomer** is Copyright (C) 2012 Michael Barton <http://michaelbarton.me.uk>

data/man/genomer-view-gff.ronn

@@ -0,0 +1,34 @@
+# GENOMER-VIEW-GFF 1
+
+## NAME
+
+genomer-view-gff(1) -- Generate GFF3 view of genome scaffold annotations
+
+## SYNOPSIS
+
+`genomer view gff [<annotation-options>]`
+
+## DESCRIPTION
+
+**Genomer-view-gff** produces a [GFF3 formatted][gff] view of the genome
+scaffold annotations. The IDs and coordinates of the annotations are updated to
+reflect the locations of the source contigs in the genome scaffold. The man
+page genomer-view(1) provides a listing of the \<annotation-options\> which may
+be passed as arguments to update the annotations.
+
+[gff]: http://www.sequenceontology.org/gff3.shtml
+
+## EXAMPLES
+
+    $ genomer view gff					 \
+      --reset_locus_numbering=52 \
+      --prefix='I1A_'
+
+## BUGS
+
+**Genomer-view** is written in Ruby and depends on the genomer gem. See the 
+Gemfile in the genomer-plugin-view gem install directory for version details.
+
+## COPYRIGHT
+
+**Genomer** is Copyright (C) 2012 Michael Barton <http://michaelbarton.me.uk>

data/man/genomer-view-mapping.ronn

@@ -0,0 +1,30 @@
+# GENOMER-VIEW-MAPPING 1
+
+## NAME
+
+genomer-view-mapping(1) -- Show mapping between original gene ID and new gene ID
+
+## SYNOPSIS
+
+`genomer view mapping [<annotation-options>]`
+
+## DESCRIPTION
+
+**Genomer-view-mapping** produces two tab-delimited columns showing the
+relationship between the IDs of the original annotations and the updated genome
+annotations produce by genomer. This list may be useful for updating other
+documents containing gene IDS. The man page genomer-view(1) provides a listing
+of the \<annotation-options\> which may be passed as arguments.
+
+## EXAMPLES
+
+    $ genomer view mapping
+
+## BUGS
+
+**Genomer-view** is written in Ruby and depends on the genomer gem. See the 
+Gemfile in the genomer-plugin-view gem install directory for version details.
+
+## COPYRIGHT
+
+**Genomer** is Copyright (C) 2012 Michael Barton <http://michaelbarton.me.uk>

data/man/genomer-view-table.ronn

@@ -0,0 +1,40 @@
+# GENOMER-VIEW-TABLE 1
+
+## NAME
+
+genomer-view-table(1) -- Generate a GenBank table view of genome scaffold annotations
+
+## SYNOPSIS
+
+`genomer view table [<annotation-options>]`
+
+## DESCRIPTION
+
+**Genomer-view-table** produces a table view of the genome annotations,
+suitable for use with [tbl2asn][] to upload a genome assembly to GenBank. This
+requires an **annotation.gff** file containing [GFF3 formatted][gff]
+annotations be present in the assembly directory. The resulting IDs and
+coordinates of the annotations are updated to reflect the locations of the
+source contigs in the genome scaffold. The man page genomer-view(1) provides a
+listing of the \<annotation-options\> which may be passed as arguments to
+update the annotations.
+
+[tbl2asn]: https://www.ncbi.nlm.nih.gov/genbank/tbl2asn2/
+[gff]: http://www.sequenceontology.org/gff3.shtml
+
+## EXAMPLES
+
+    genomer view table					                      \
+      --identifier=PRJNA68653                         \
+      --reset_locus_numbering=52                      \
+      --prefix='I1A_'                                 \
+      --generate_encoded_features='gnl|BartonUAkron|' \
+
+## BUGS
+
+**Genomer-view** is written in Ruby and depends on the genomer gem. See the 
+Gemfile in the genomer-plugin-view gem install directory for version details.
+
+## COPYRIGHT
+
+**Genomer** is Copyright (C) 2012 Michael Barton <http://michaelbarton.me.uk>

data/man/genomer-view.ronn

@@ -1,9 +1,12 @@
+# GENOMER-VIEW 1
+
+## NAME
+
 genomer-view(1) -- Generate file format views of scaffold and annotations
-=========================================================================
 
 ## SYNOPSIS
 
-`genomer view` <flatfile-type> [<options>...]
+`genomer view` \<flatfile-type\> [\<options\>...]
 
 ## DESCRIPTION
 
@@ -13,32 +16,32 @@ the **flat-file** argument.
 
 ## OPTIONS
 
-  * `--identifier`=[<identifier>]:
+  * `--identifier`=[\<identifier\>]:
     The sequence identifier to include in generated flatfile outputs.
 
-  * `--strain`=[<strain>]:
+  * `--strain`=[\<strain\>]:
     The strain of the source organism.
     
-  * `--organism`=[<organism>]:
+  * `--organism`=[\<organism\>]:
     The genus and species, enclosed in single quotes, of the source organism.
 
-  * `--prefix`=[<gene-prefix>]:
-    Prepend all ID attributes from the annotation file with <gene-prefix> in 
+  * `--prefix`=[\<gene-prefix\>]:
+    Prepend all ID attributes from the annotation file with \<gene-prefix\> in 
     the generated output.
 
   * `--reset_locus_numbering`:
     Reset gene ID to begin at 1 from the start of the sequence in the generated 
     output file.
 
-  * `--generate_encoded_features`=[<feature-prefix>]:
+  * `--generate_encoded_features`=[\<feature-prefix\>]:
     Generate corresponding 1:1 encoded feature entries from the genes entries 
     in the annotation file. These will commonly be CDS entries but RNA type 
     entries are also supported. The feature IDs are generated from the 
-    corresponding gene ID prefixed with the <feature-prefix>.
+    corresponding gene ID prefixed with the \<feature-prefix\>.
 
 ## GFF NINTH COLUMN ATTRIBUTES
 
-The annotation file should be in GFF3 format and contain the annotations for 
+The source annotation file should be in GFF3 format and contain the annotations for 
 the scaffolded contigs. The default location for this file is
 **assembly/annotations.gff**. The following attributes in the GFF3 file are 
 treated specially by genomer when generating flat file output.
@@ -51,7 +54,7 @@ begin with an upper case letter.
   * `ID`:
     Used to specify the ID of annotations in the output. If the 
     `--generate_encoded_features` option is passed, the encoded features have 
-    an ID generated from this field prefixed with the <feature-prefix> 
+    an ID generated from this field prefixed with the \<feature-prefix\> 
     argument. This field should be unique in the annotation file.
 
   * `Name`:
@@ -96,7 +99,6 @@ section.
     **product** attributes are present. See the next section for an explanation 
     of this.
 
-
 ### OVERLAP BETWEEN NAME, PRODUCT AND FUNCTION FIELD
 
 The genbank annotation table **product** fields may contain either a short four 

metadata

@@ -1,7 +1,7 @@
 --- !ruby/object:Gem::Specification
 name: genomer-plugin-view
 version: !ruby/object:Gem::Version
-  version: 0.0.4
+  version: 0.0.5
   prerelease: 
 platform: ruby
 authors:
@@ -9,7 +9,7 @@ authors:
 autorequire: 
 bindir: bin
 cert_chain: []
-date: 2013-01-16 00:00:00.000000000 Z
+date: 2013-01-25 00:00:00.000000000 Z
 dependencies:
 - !ruby/object:Gem::Dependency
   name: genomer
@@ -135,14 +135,17 @@ files:
 - .travis.yml
 - Gemfile
 - LICENSE.txt
-- README.rdoc
+- README.md
 - Rakefile
-- features/agp/generation.feature
+- features/agp/core.feature
+- features/core.feature
 - features/fasta/contigs.feature
+- features/fasta/core.feature
 - features/fasta/single_sequence.feature
 - features/gff/core.feature
 - features/mappings/core.feature
 - features/support/env.rb
+- features/support/genomer_steps.rb
 - features/table/cds_entries.feature
 - features/table/core.feature
 - features/table/feature_type.feature
@@ -156,6 +159,10 @@ files:
 - lib/genomer-plugin-view/table.rb
 - lib/genomer-plugin-view/version.rb
 - man/genomer-view-agp.ronn
+- man/genomer-view-fasta.ronn
+- man/genomer-view-gff.ronn
+- man/genomer-view-mapping.ronn
+- man/genomer-view-table.ronn
 - man/genomer-view.ronn
 - spec/genomer-view-plugin/agp_spec.rb
 - spec/genomer-view-plugin/fasta_spec.rb
@@ -180,7 +187,7 @@ required_ruby_version: !ruby/object:Gem::Requirement
       version: '0'
       segments:
       - 0
-      hash: 2531486959390668075
+      hash: -207727351507926591
 required_rubygems_version: !ruby/object:Gem::Requirement
   none: false
   requirements:

data/README.rdoc

@@ -1,19 +0,0 @@
-= genomer-plugin-view
-
-Description goes here.
-
-== Contributing to genomer-plugin-view
- 
-* Check out the latest master to make sure the feature hasn't been implemented or the bug hasn't been fixed yet
-* Check out the issue tracker to make sure someone already hasn't requested it and/or contributed it
-* Fork the project
-* Start a feature/bugfix branch
-* Commit and push until you are happy with your contribution
-* Make sure to add tests for it. This is important so I don't break it in a future version unintentionally.
-* Please try not to mess with the Rakefile, version, or history. If you want to have your own version, or is otherwise necessary, that is fine, but please isolate to its own commit so I can cherry-pick around it.
-
-== Copyright
-
-Copyright (c) 2011 Michael Barton. See LICENSE.txt for
-further details.
-