bio-synreport 0.1.0 → 0.1.1

data/.document

@@ -0,0 +1,5 @@
+lib/**/*.rb
+bin/*
+- 
+features/**/*.feature
+LICENSE.txt

data/README.rdoc

@@ -1,6 +1,29 @@
 = bio-synreport
 
-Description goes here.
+A gem that takes gene CDS sequences and GFF as input. From this a database is created and the user can interrogate the database object.The user may then pass a chromosome ID, a position and an alternative nucleotide. The database will return information about whether the suggested substitution creates a synonymous or non-synonymous substitution, and the identity of the changes as a hash with many attributes.
+
+For example,
+
+  	 db = Bio::Util::SynReport.new(:gff => 'some_gff.gff', :fasta => 'some_cds.fa', :verbose => true)
+  	 chr, pos, ref,alt = 'Chr2', 15973794, 'C', 'T'
+  	 pp db.mutation_info(chr,pos,alt) 
+
+Would return something like,
+    {
+    :chr => 'Chr2', 
+    :strand => '-', 
+    :position => 15973794,
+    :original_codon => 'atg', 
+    :original_residue => 'Met', 
+    :mutant_codon => 'ttg', 
+    :mutant_residue => 'Lys', 
+    :position_in_codon => 1, 
+    :substitution_type => 'NON_SYN'
+     }
+
+== To Do
+
+The module isn't the fastest thing in the world. Needs much speeding up...
 
 == Contributing to bio-synreport
  

data/VERSION

@@ -1 +1 @@
-0.1.0
+0.1.1

data/bio-synreport.gemspec

@@ -4,19 +4,20 @@
 # -*- encoding: utf-8 -*-
 
 Gem::Specification.new do |s|
-  s.name = "bio-synreport"
-  s.version = "0.1.0"
+  s.name = %q{bio-synreport}
+  s.version = "0.1.1"
 
   s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version=
   s.authors = ["Dan MacLean"]
-  s.date = "2012-11-21"
-  s.description = "Takes a GFF and genomic sequence file, constructs CDS and when given a position and alternative base will report whether this change is in a coding region and if it results in a synonymous or non-synonymous mutation."
-  s.email = "maclean.daniel@gmail.com"
+  s.date = %q{2013-05-16}
+  s.description = %q{Takes a GFF and genomic sequence file, constructs CDS and when given a position and alternative base will report whether this change is in a coding region and if it results in a synonymous or non-synonymous mutation.}
+  s.email = %q{maclean.daniel@gmail.com}
   s.extra_rdoc_files = [
     "LICENSE.txt",
     "README.rdoc"
   ]
   s.files = [
+    ".document",
     "Gemfile",
     "Gemfile.lock",
     "LICENSE.txt",
@@ -24,22 +25,26 @@ Gem::Specification.new do |s|
     "Rakefile",
     "VERSION",
     "bio-synreport.gemspec",
+    "examples/test.fa",
+    "examples/test.gff",
     "examples/test.rb",
     "lib/bio-synreport.rb",
     "lib/bio/utils/bio-synreport.rb",
     "test/helper.rb",
+    "test/sample.gff",
     "test/test_bio-synreport.rb"
   ]
-  s.homepage = "http://github.com/danmaclean/bioruby-synreport"
+  s.homepage = %q{http://github.com/danmaclean/bioruby-synreport}
   s.licenses = ["MIT"]
   s.require_paths = ["lib"]
-  s.rubygems_version = "1.8.11"
-  s.summary = "Reports whether a nucleotide change results in synonymous or non-synonymous mutations"
+  s.rubygems_version = %q{1.3.6}
+  s.summary = %q{Reports whether a nucleotide change results in synonymous or non-synonymous mutations}
 
   if s.respond_to? :specification_version then
+    current_version = Gem::Specification::CURRENT_SPECIFICATION_VERSION
     s.specification_version = 3
 
-    if Gem::Version.new(Gem::VERSION) >= Gem::Version.new('1.2.0') then
+    if Gem::Version.new(Gem::RubyGemsVersion) >= Gem::Version.new('1.2.0') then
       s.add_development_dependency(%q<shoulda>, [">= 0"])
       s.add_development_dependency(%q<bundler>, ["~> 1.0.0"])
       s.add_development_dependency(%q<jeweler>, ["~> 1.6.4"])

data/examples/test.fa

@@ -0,0 +1,57 @@
+>AT2G17530.1 | Symbols:  | Protein kinase superfamily protein | chr2:7626518-7628624 FORWARD LENGTH=1323
+ATGTCGTGTTCATCCTCATCTGGATCAGAGGAAGACGATGAGGGTTTCGATGCTTACCGT
+AAAGGTGGATATCACGCCGTTAGAATCGGAGACCAGTTTGCCGGTGGCCGTTACATTGCT
+CAGAGAAAGCTTGGTTGGGGCCAATTCTCCACCGTTTGGCTTGCCTATGATACTCGCACT
+TCTAATTATGTTGCTTTGAAGATTCAGAAGAGCGCCTTACAATTTGCTCAAGCTGCACTT
+CATGAAATCGAACTTCTTCAAGCTGCTGCTGATGGGGATCCTGAAAATACCAAGTGTGTT
+ATTCGTCTTATTGATGACTTCAAGCACGCAGGTCCCAACGGGCAGCATTTATGCATGGTG
+CTCGAGTTTCTTGGCGATAGCTTGCTGCGTTTGATTAAATATAACCGTTATAAAGGGATG
+GAGTTAAGTAAAGTGCGGGAGATATGCAAATGTATACTGACTGGTCTAGATTATTTGCAC
+CGTGAACTCGGTATGATTCACTCCGACTTAAAACCCGAAAACATTCTTCTTTGTTCCACC
+ATTGACCCTGCCAAGGATCCTATCAGATCCGGACTAACACCGATACTAGAAAAGCCCGAG
+GGGAACCAAAACGGTACATCAACAATGAATCTGATTGAGAAGAAGTTGAAGAGGAGAGCA
+AAAAAAGCGGCTGCTAAAATATCAGGAAGAAGAGTTTCGATAGTAGGTTTAAGTGAAACA
+CCGAAAAAGAACAAGAGAAACTTGGATGGGATTGATATGAGATGCAAAGTTGTCGACTTC
+GGGAACGGGTGTTGGGCTGATAACAAATTTGCAGAAGAAATACAAACAAGACAGTACAGA
+GCTCCTGAAGTAATACTTCAGTCAGGTTACTCTTACTCTGTTGATATGTGGTCTTTCGCT
+TGTACTGCTTTTGAGCTTGCTACAGGCGATATGCTTTTCGCTCCAAAAGAGGGAAATGGT
+TACGGAGAAGACGAGGACCACCTTGCTCTTATGATGGAACTCTTAGGAAAAATGCCTCGA
+AAGATTGCCATTGGAGGTGCGAGATCAAAGGATTACTTTGACAGACACGGCGACTTGAAG
+AGGATCCGGAGATTAAAATACTGGCCACTCGACCGTTTACTGATTGATAAATACAAGCTT
+CCAGAAGCAGAAGCACGAGAATTTGCGGATTTTCTCTGCCCGATAATGGATTTTGCACCT
+GAGAAACGACCAACTGCACAACAATGTCTGCAACATCCATGGTTGAATCTAAGGACACAG
+AACAATGAAGATGATATAGAAGGTCAGATGAGTAACATGCAGATCAAAGGTTCATGTTCT
+TGA
+>AT2G38120.1 | Symbols: AUX1, WAV5, PIR1, MAP1 | Transmembrane amino acid transporter family protein | chr2:15973493-15976792 FORWARD LENGTH=1458
+ATGTCGGAAGGAGTAGAAGCGATAGTAGCAAATGACAACGGAACAGATCAGGTAAACGGA
+AACCGTACCGGGAAAGATAACGAAGAACACGACGGCTCCACCGGTTCTAACCTAAGCAAT
+TTCCTATGGCACGGTGGCTCTGTCTGGGACGCTTGGTTCAGCTGCGCATCTAACCAAGTG
+GCTCAAGTGTTATTGACATTACCGTACTCGTTTAGTCAACTAGGAATGTTATCAGGAATA
+GTACTTCAGATCTTCTATGGTTTACTAGGAAGCTGGACTGCTTATCTCATCTCTGTTCTC
+TACGTCGAATACAGAGCTCGTAAAGAAAAAGAAGGCAAAAGCTTCAAAAACCACGTCATT
+CAGTGGTTTGAAGTACTTGATGGATTACTTGGTTCATACTGGAAAGCACTAGGACTCGCA
+TTTAATTGCACTTTCCTCTTGTTTGGATCTGTTATCCAACTCATTGCTTGTGCCAGTAAC
+ATTTATTACATAAACGATCATCTGGACAAGAGAACATGGACTTACATATTTGGCGCGTGT
+TGTGCAACCACTGTCTTTATACCGTCGTTTCACAATTACCGAATTTGGTCATTCCTTGGC
+CTTGGAATGACCACTTACACCGCTTGGTACTTAGCCATTGCCTCCATCATCCACGGCCAG
+GCGGAAGGTGTGAAACATTCAGGTCCAACAAAGCTAGTGCTTTATTTTACGGGAGCCACA
+AATATTTTGTACACCTTTGGAGGTCACGCGGTTACTGTTGAGATTATGCATGCTATGTGG
+AAACCACAGAAGTTTAAGTACATTTACTTGATGGCGACGTTATACGTGTTCACGCTAACG
+ATTCCGTCAGCTGCCGCCGTTTACTGGGCTTTCGGAGACGCACTTCTCGACCACTCCAAC
+GCTTTCTCTCTTATGCCCAAGAACGCGTGGCGTGACGCCGCTGTTATCCTCATGCTCATT
+CATCAGTTTATAACGTTCGGGTTCGCTTGTACACCTTTGTACTTTGTGTGGGAGAAAGTG
+ATTGGGATGCATGACACAAAGAGCATTTGCTTAAGGGCTTTGGCTAGATTGCCTGTGGTC
+ATACCTATTTGGTTCTTAGCTATTATCTTCCCCTTTTTCGGTCCAATCAATTCCGCTGTC
+GGTGCTCTTCTTGTTAGCTTCACCGTCTATATCATCCCATCTCTCGCTCACATGCTCACT
+TACCGATCTGCCTCCGCTCGTCAGAATGCGGCGGAGAAGCCACCGTTCTTTATGCCGAGC
+TGGACGGCGATGTACGTGTTGAATGCTTTCGTGGTGGTTTGGGTTCTTATAGTCGGATTT
+GGGTTCGGTGGATGGGCTAGTGTAACCAACTTTGTTCGTCAAGTCGACACTTTTGGTCTC
+TTTGCCAAGTGTTACCAATGTAAACCAGCTGCAGCCGCCGCACATGCCCCGGTCTCCGCT
+TTACACCACCGTCTTTGA
+>AT3G01325.1 | Symbols:  | Expressed protein | chr3:123412-123720 REVERSE LENGTH=309
+ATGGAACTAAAACAAACCAAAGTGATGTTTTTCTTGGTAGCCCTAATCTTGGCATTGAAT
+TTCCGACCATCGGAAGCAGCTCCGCCGGTCAGATATTGTTCAACATTATTCATAGAAAGA
+GCGCCAAGATGTTACGAAGCGTTGAGAAGAGCGGTGCACAGAGATGTTAGTTTGTTAACA
+GGAAAATGCTGCAGAGCAGTATTCGCAACACTTCCAGTTACTTGCTTCTTGAAACTTACT
+TCTGAACTTGAATTGCCAATGACTAACTTCAGAAATATTTGTGATGCTGTTAAGCCTCCA
+ACTTCATGA

data/examples/test.gff

@@ -0,0 +1,56 @@
+Chr2	TAIR10	mRNA	7626359	7629149	.	+	.	ID=AT2G17530.1;Parent=AT2G17530;Name=AT2G17530.1;Index=1
+Chr2	TAIR10	protein	7626518	7628624	.	+	.	ID=AT2G17530.1-Protein;Name=AT2G17530.1;Derives_from=AT2G17530.1
+Chr2	TAIR10	exon	7626359	7626700	.	+	.	Parent=AT2G17530.1
+Chr2	TAIR10	five_prime_UTR	7626359	7626517	.	+	.	Parent=AT2G17530.1
+Chr2	TAIR10	CDS	7626518	7626700	.	+	0	Parent=AT2G17530.1,AT2G17530.1-Protein;
+Chr2	TAIR10	exon	7627310	7628101	.	+	.	Parent=AT2G17530.1
+Chr2	TAIR10	CDS	7627310	7628101	.	+	0	Parent=AT2G17530.1,AT2G17530.1-Protein;
+Chr2	TAIR10	exon	7628198	7628245	.	+	.	Parent=AT2G17530.1
+Chr2	TAIR10	CDS	7628198	7628245	.	+	0	Parent=AT2G17530.1,AT2G17530.1-Protein;
+Chr2	TAIR10	exon	7628325	7629149	.	+	.	Parent=AT2G17530.1
+Chr2	TAIR10	CDS	7628325	7628624	.	+	0	Parent=AT2G17530.1,AT2G17530.1-Protein;
+Chr2	TAIR10	three_prime_UTR	7628625	7629149	.	+	.	Parent=AT2G17530.1
+Chr2	TAIR10	mRNA	15972993	15977180	.	+	.	ID=AT2G38120.1;Parent=AT2G38120;Name=AT2G38120.1;Index=1
+Chr2	TAIR10	protein	15973493	15976792	.	+	.	ID=AT2G38120.1-Protein;Name=AT2G38120.1;Derives_from=AT2G38120.1
+Chr2	TAIR10	exon	15972993	15973264	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	five_prime_UTR	15972993	15973264	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	exon	15973476	15973669	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	five_prime_UTR	15973476	15973492	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	CDS	15973493	15973669	.	+	0	Parent=AT2G38120.1,AT2G38120.1-Protein;
+Chr2	TAIR10	exon	15973763	15973948	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	CDS	15973763	15973948	.	+	0	Parent=AT2G38120.1,AT2G38120.1-Protein;
+Chr2	TAIR10	exon	15974037	15974149	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	CDS	15974037	15974149	.	+	0	Parent=AT2G38120.1,AT2G38120.1-Protein;
+Chr2	TAIR10	exon	15974246	15974429	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	CDS	15974246	15974429	.	+	1	Parent=AT2G38120.1,AT2G38120.1-Protein;
+Chr2	TAIR10	exon	15974708	15974805	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	CDS	15974708	15974805	.	+	0	Parent=AT2G38120.1,AT2G38120.1-Protein;
+Chr2	TAIR10	exon	15975327	15975534	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	CDS	15975327	15975534	.	+	1	Parent=AT2G38120.1,AT2G38120.1-Protein;
+Chr2	TAIR10	exon	15975621	15975878	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	CDS	15975621	15975878	.	+	0	Parent=AT2G38120.1,AT2G38120.1-Protein;
+Chr2	TAIR10	exon	15976559	15977180	.	+	.	Parent=AT2G38120.1
+Chr2	TAIR10	CDS	15976559	15976792	.	+	0	Parent=AT2G38120.1,AT2G38120.1-Protein;
+Chr2	TAIR10	three_prime_UTR	15976793	15977180	.	+	.	Parent=AT2G38120.1
+Chr3	TAIR10	mRNA	123369	123741	.	-	.	ID=AT3G01325.1;Parent=AT3G01325;Name=AT3G01325.1;Index=1
+Chr3	TAIR10	protein	123412	123720	.	-	.	ID=AT3G01325.1-Protein;Name=AT3G01325.1;Derives_from=AT3G01325.1
+Chr3	TAIR10	five_prime_UTR	123721	123741	.	-	.	Parent=AT3G01325.1
+Chr3	TAIR10	CDS	123412	123720	.	-	0	Parent=AT3G01325.1,AT3G01325.1-Protein;
+Chr3	TAIR10	three_prime_UTR	123369	123411	.	-	.	Parent=AT3G01325.1
+Chr3	TAIR10	exon	123369	123741	.	-	.	Parent=AT3G01325.1
+Chr2	TAIR10	mRNA	15978512	15980749	.	-	.	ID=AT2G38130.1;Parent=AT2G38130;Name=AT2G38130.1;Index=1
+Chr2	TAIR10	protein	15978639	15980145	.	-	.	ID=AT2G38130.1-Protein;Name=AT2G38130.1;Derives_from=AT2G38130.1
+Chr2	TAIR10	five_prime_UTR	15980638	15980749	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	exon	15980638	15980749	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	five_prime_UTR	15980470	15980503	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	exon	15980470	15980503	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	five_prime_UTR	15980146	15980234	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	CDS	15979966	15980145	.	-	0	Parent=AT2G38130.1,AT2G38130.1-Protein;
+Chr2	TAIR10	exon	15979966	15980234	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	CDS	15979746	15979866	.	-	0	Parent=AT2G38130.1,AT2G38130.1-Protein;
+Chr2	TAIR10	exon	15979746	15979866	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	CDS	15979551	15979606	.	-	2	Parent=AT2G38130.1,AT2G38130.1-Protein;
+Chr2	TAIR10	exon	15979551	15979606	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	CDS	15978639	15978854	.	-	0	Parent=AT2G38130.1,AT2G38130.1-Protein;
+Chr2	TAIR10	three_prime_UTR	15978512	15978638	.	-	.	Parent=AT2G38130.1
+Chr2	TAIR10	exon	15978512	15978854	.	-	.	Parent=AT2G38130.1

data/examples/test.rb

@@ -9,6 +9,7 @@ $LOAD_PATH.unshift(File.dirname(__FILE__))
   #this is how you use it... no really! 
   
   db = Bio::Util::SynReport.new(:gff => ARGV[0], :fasta => ARGV[1], :verbose => true)
+
   chr, pos, ref,alt = 'Chr2',7634495, 'a', 't'
   pp db.mutation_info(chr,pos,alt) 
   
@@ -16,4 +17,5 @@ $LOAD_PATH.unshift(File.dirname(__FILE__))
   pp db.mutation_info(chr,pos,alt)
   
     chr, pos, ref,alt = 'Chr2',7626518, 'a', 't'
-  pp db.mutation_info(chr,pos,alt) 
+  pp db.mutation_info(chr,pos,alt) 
+

data/lib/bio/utils/bio-synreport.rb

@@ -5,6 +5,80 @@ require 'bio'
 module Bio
   class Util
     
+<<<<<<< HEAD
+    class MrnaModel < Bio::GFF::GFF3::Record
+      attr_accessor :seq, :cds
+      def initialize(gff_line)
+        super gff_line
+        @cds = []
+      end
+      
+      def includes?(seq, point)
+        return true if self.seqname == seq and point.to_i >= self.cds_start and point.to_i <= self.cds_end
+        false
+      end
+      
+      def cds_start
+        @cds.flatten.min
+      end
+  
+      def cds_end
+        @cds.flatten.max
+      end
+      
+      def get_nt_number_in_cds(point)
+        to_count = @cds.sort.select {|a| a.first <= point}
+        in_block = to_count.pop
+        distance_in = to_count.inject(1) {|tot, b| tot + ( b.last - b.first) + 1 }
+        overhang =  point - in_block.first 
+        left_section = distance_in + overhang
+        
+        if self.strand == '-'
+            length = @cds.sort.inject(0) {|tot, b| tot + ( b.last - b.first) + 1 }
+            return length - left_section + 1
+        end
+        
+        return left_section
+      end
+      
+      def codon_index(dist)
+        (dist - 1) / 3
+      end
+      
+      def codon_position(dist)
+        (dist - 1) % 3
+      end
+      
+      def codon_array
+        codon_array = []; Bio::Sequence::NA.new(self.seq).window_search(3,3) {|b| codon_array << b}
+        codon_array
+      end
+      
+      def nt
+      end
+      
+      ##returns codon and position of nucleotide 
+      def codon_and_index(point)
+         distance_into_cds = get_nt_number_in_cds point
+         codon_idx = codon_index distance_into_cds
+         codon_list = codon_array
+         codon = codon_list[codon_idx]
+         pos = codon_position(distance_into_cds)
+         [codon,pos]
+      end
+      
+      def substitution_info(point,alt)
+            codon, position = codon_and_index(point)
+            new_codon = codon.dup
+            new_codon[position] = alt.downcase
+            
+            a = Bio::Sequence::NA.new(codon).translate.codes.first
+            b =  Bio::Sequence::NA.new(new_codon).translate.codes.first
+            sub_type = a == b ? "SYN" : "NON_SYN"
+            return {#:id => self.gffid, 
+                    :chr => self.seqname, 
+                    :strand => self.strand, 
+=======
     class MrnaModel
       attr_accessor :seqname, :gff_id, :strand, :cds, :sequences
   
@@ -48,11 +122,17 @@ module Bio
             return {:id => @gff_id, 
                     :chr => @seqname, 
                     :strand => @strand, 
+>>>>>>> 188a1a611ad6334046551c7bba186dc1c7ae85af
                     :position => point,
                     :original_codon => codon, 
                     :original_residue => a || 'stop', 
                     :mutant_codon => new_codon, 
                     :mutant_residue =>b || 'stop', 
+<<<<<<< HEAD
+                    :position_in_codon => position + 1, 
+                    :substitution_type => sub_type
+                    }
+=======
                     :position_in_codon => position_in_codon + 1, 
                     :substitution_type => sub_type
                     }
@@ -60,6 +140,7 @@ module Bio
           running_total += (stop - start)
           running_total += 1 if @strand == '-' #how far we are into the cds
         end
+>>>>>>> 188a1a611ad6334046551c7bba186dc1c7ae85af
       end
       
     end#class end
@@ -69,6 +150,47 @@ module Bio
       #attr_accessor :cdshash, :cds_list, :mRNAhash, :seqhash
       
       def initialize(opts)
+<<<<<<< HEAD
+        cdses = []
+        mrna_list = []
+        seqs = Hash.new
+        
+        Bio::FastaFormat.open(opts[:fasta]).each { |seq| seqs[seq.entry_id] = seq.to_seq }
+        $stderr.puts "Loaded Seq..." if opts[:verbose]
+        
+        
+        @mrnas = Hash.new  {|h,k| h[k] = Hash.new}
+        File.open(opts[:gff], "r").each do |gffline|
+          record = Bio::GFF::GFF3::Record.new(gffline)
+          if record.feature_type == 'mRNA'
+            mrna_list << Bio::Util::MrnaModel.new(gffline)
+          elsif record.feature_type =='CDS'
+            cdses << record
+          end
+        end
+        
+        mrna_list.each do |mrna|
+          mrna_id = mrna.get_attributes("ID")
+          $stderr.puts "No ID for #{cds}" if mrna_id.empty?
+          mrna_id = mrna_id.first
+          @mrnas[mrna.seqname][mrna_id] = mrna
+          @mrnas[mrna.seqname][mrna_id].seq = seqs[mrna_id].seq
+        end
+        
+        cdses.each do |cds|
+          cds_parent = cds.get_attributes("Parent")
+          $stderr.puts "No Parent for #{cds}" if cds_parent.empty?
+          cds_parent = cds_parent.first
+          @mrnas[cds.seqname][cds_parent].cds << [cds.start,cds.end]
+        end
+        $stderr.puts "Loaded GFF..." if opts[:verbose]
+
+
+      end#init end
+        
+        def is_in_cds?(chr,point)
+          self.mutation_info(chr,point,"a") ? true : false
+=======
         @gene_array = []
         @cdshash = Hash.new {|h,k| h[k] = Hash.new {|a,b| a[b] = [] } }
         @mRNAhash = Hash.new {|h,k| h[k] = Hash.new {|a,b| a[b] = [] } }
@@ -124,10 +246,27 @@ module Bio
         
         def is_in_cds?(chr,point)
           @self.mutation_info(chr,point) ? true : false
+>>>>>>> 188a1a611ad6334046551c7bba186dc1c7ae85af
         end
         
         #returns mutation info if point in CDS, if not in CDS returns false
         def mutation_info(chr,pos,alt)
+<<<<<<< HEAD
+          pos = pos.to_i
+          #cant do indels ...
+          return nil if alt.length > 1
+          begin
+            @mrnas[chr].each_pair do |mrna_id, mrna|
+              if mrna.includes?(chr,pos)
+                return mrna.substitution_info(pos,alt)   
+              end
+           end
+            false
+          rescue
+            #somthing unpredicatable went wrong and we couldnt do the conversion ...
+            return nil
+          end
+=======
 
           @models[chr].each do |m|
              if m.includes?(chr,pos)
@@ -135,6 +274,7 @@ module Bio
              end
           end
           false
+>>>>>>> 188a1a611ad6334046551c7bba186dc1c7ae85af
         end
         
         

data/test/sample.gff

@@ -0,0 +1,14 @@
+ctg123	.	gene	1000	9000	.	+	.	ID=gene00001;Name=EDEN	
+ctg123	.	TF_binding_site	1000	1012	.	+	.	ID=tfbs00001;Parent=gene00001	
+ctg123	.	mRNA	1050	9000	.	+	.	ID=mRNA00001;Parent=gene00001;Name=EDEN.1	
+ctg123	.	mRNA	1050	9000	.	+	.	ID=mRNA00002;Parent=gene00001;Name=EDEN.2	
+ctg123	.	mRNA	1300	9000	.	+	.	ID=mRNA00003;Parent=gene00001;Name=EDEN.3	
+ctg123	.	exon	1300	1500	.	+	.	ID=exon00001;Parent=mRNA00003	
+ctg123	.	exon	1050	1500	.	+	.	ID=exon00002;Parent=mRNA00001,mRNA00002	
+ctg123	.	exon	3000	3902	.	+	.	ID=exon00003;Parent=mRNA00001,mRNA00003	
+ctg123	.	exon	5000	5500	.	+	.	ID=exon00004;Parent=mRNA00001,mRNA00002,mRNA00003	
+ctg123	.	exon	7000	9000	.	+	.	ID=exon00005;Parent=mRNA00001,mRNA00002,mRNA00003	
+ctg123	.	CDS	1201	1500	.	+	0	ID=cds00001;Parent=mRNA00001;Name=edenprotein.1	
+ctg123	.	CDS	3000	3902	.	+	0	ID=cds00001;Parent=mRNA00001;Name=edenprotein.1	
+ctg123	.	CDS	5000	5500	.	+	0	ID=cds00001;Parent=mRNA00001;Name=edenprotein.1	
+ctg123	.	CDS	7000	7600	.	+	0	ID=cds00001;Parent=mRNA00001;Name=edenprotein.1	

data/test/test_bio-synreport.rb

@@ -1,7 +1,216 @@
 require 'helper'
 
+
+class TestMrnaModel < Test::Unit::TestCase
+  
+  def setup
+    @AT2G17530_1 = Bio::Util::MrnaModel.new('Chr2	TAIR10	mRNA	7626359	7629149	.	+	.	ID=AT2G17530.1;Parent=AT2G17530;Name=AT2G17530.1;Index=1')
+    @AT2G17530_1.cds = [ [7626518,7626700],[7627310,7628101],[7628198,7628245], [7628325,7628624] ]
+    @AT2G17530_1.seq = "ATGTCGTGTTCATCCTCATCTGGATCAGAGGAAGACGATGAGGGTTTCGATGCTTACCGT
+AAAGGTGGATATCACGCCGTTAGAATCGGAGACCAGTTTGCCGGTGGCCGTTACATTGCT
+CAGAGAAAGCTTGGTTGGGGCCAATTCTCCACCGTTTGGCTTGCCTATGATACTCGCACT
+TCTAATTATGTTGCTTTGAAGATTCAGAAGAGCGCCTTACAATTTGCTCAAGCTGCACTT
+CATGAAATCGAACTTCTTCAAGCTGCTGCTGATGGGGATCCTGAAAATACCAAGTGTGTT
+ATTCGTCTTATTGATGACTTCAAGCACGCAGGTCCCAACGGGCAGCATTTATGCATGGTG
+CTCGAGTTTCTTGGCGATAGCTTGCTGCGTTTGATTAAATATAACCGTTATAAAGGGATG
+GAGTTAAGTAAAGTGCGGGAGATATGCAAATGTATACTGACTGGTCTAGATTATTTGCAC
+CGTGAACTCGGTATGATTCACTCCGACTTAAAACCCGAAAACATTCTTCTTTGTTCCACC
+ATTGACCCTGCCAAGGATCCTATCAGATCCGGACTAACACCGATACTAGAAAAGCCCGAG
+GGGAACCAAAACGGTACATCAACAATGAATCTGATTGAGAAGAAGTTGAAGAGGAGAGCA
+AAAAAAGCGGCTGCTAAAATATCAGGAAGAAGAGTTTCGATAGTAGGTTTAAGTGAAACA
+CCGAAAAAGAACAAGAGAAACTTGGATGGGATTGATATGAGATGCAAAGTTGTCGACTTC
+GGGAACGGGTGTTGGGCTGATAACAAATTTGCAGAAGAAATACAAACAAGACAGTACAGA
+GCTCCTGAAGTAATACTTCAGTCAGGTTACTCTTACTCTGTTGATATGTGGTCTTTCGCT
+TGTACTGCTTTTGAGCTTGCTACAGGCGATATGCTTTTCGCTCCAAAAGAGGGAAATGGT
+TACGGAGAAGACGAGGACCACCTTGCTCTTATGATGGAACTCTTAGGAAAAATGCCTCGA
+AAGATTGCCATTGGAGGTGCGAGATCAAAGGATTACTTTGACAGACACGGCGACTTGAAG
+AGGATCCGGAGATTAAAATACTGGCCACTCGACCGTTTACTGATTGATAAATACAAGCTT
+CCAGAAGCAGAAGCACGAGAATTTGCGGATTTTCTCTGCCCGATAATGGATTTTGCACCT
+GAGAAACGACCAACTGCACAACAATGTCTGCAACATCCATGGTTGAATCTAAGGACACAG
+AACAATGAAGATGATATAGAAGGTCAGATGAGTAACATGCAGATCAAAGGTTCATGTTCT
+TGA".gsub(/\n/,"")
+    
+    @AT2G38130_1 = Bio::Util::MrnaModel.new('Chr2	TAIR10	mRNA	15978512	15980749	.	-	.	ID=AT2G38130.1;Parent=AT2G38130;Name=AT2G38130.1;Index=1')
+    @AT2G38130_1.cds = [[15978639, 15978854],[15979551, 15979606],[15979746, 15979866],[15979966, 15980145]]
+    @AT2G38130_1.seq = "ATGGAGAAAGAGATGGAAGATAAAGAAGAATTCGATGAGGGTGAGATTGAGTACACGAGT
+TATGCTGGTGAGCATCATCTGCCATTGATTATGTCTCTTGTTGACCAAGAACTTAGTGAA
+CCTTACTCCATCTTTACTTACCGGTACTTCGTCTACCTCTGGCCGCAGCTATGCTTCCTG
+GCCTTTCACAAAGGTAAATGCGTAGGAACCATAGTCTGTAAGATGGGGGATCATCGACAG
+ACTTTCAGAGGGTACATCGCTATGTTGGTTGTGATTAAACCATATCGTGGCCGAGGCATA
+GCCTCAGAGCTTGTCACAAGAGCGATAAAAGCGATGATGGAATCAGGCTGTGAAGAGGTA
+ACTCTGGAGGCAGAAGTGAGTAACAAAGGAGCATTAGCACTATATGGGCGACTCGGGTTT
+ATAAGAGCCAAACGGCTATACCACTATTACTTGAATGGGATGGATGCTTTTCGCCTGAAG
+CTCTTGTTCCCTAAGCCTCGTGTACCTCAAATACCTTCTCAAGTTCAAACCCAACAAGAG
+TATGAGACCTTTCCTAGGCCTCGTGTACCTTAA".gsub(/\n/,"")
+  end
+  
+  def test_points_in_cds
+    [7626518,7626528,7627320,7628208,7628335,7628624].each do |point|
+        assert @AT2G17530_1.includes?('Chr2', point), "#{point} should be reported in cds"  
+    end
+  end
+  
+  def test_gets_end
+    assert_equal 7628624, @AT2G17530_1.cds_end, "cds has wrong end"
+  end
+  
+  def test_gets_start
+    assert_equal 7626518, @AT2G17530_1.cds_start, "cds has wrong start"
+  end
+  
+  def test_get_nt_number_in_cds
+    #at start of first cds segment, distance into cds is 1 
+    assert_equal 1, @AT2G17530_1.get_nt_number_in_cds(7626518), "Offset is wrong"
+    #at end of first cds segment distance is length of cds segment (183) 
+    assert_equal 183, @AT2G17530_1.get_nt_number_in_cds(7626700), "Offset is wrong"
+    #at start of second cds segment distances is length of first + distance into second (1) = 184
+    assert_equal 184,  @AT2G17530_1.get_nt_number_in_cds(7627310), "Offset is wrong"
+    #ten into second cds segment distance is length of first (184) + distance into second (10) = 194
+    assert_equal 194,  @AT2G17530_1.get_nt_number_in_cds(7627320), "Offset is wrong"
+    #last position is length of all cds segments
+    assert_equal 1323, @AT2G17530_1.get_nt_number_in_cds(7628624), "offset is offset"
+    
+    #now negative strand gene
+    #at end of last cds segment, distance into cds is 1 
+    assert_equal 1, @AT2G38130_1.get_nt_number_in_cds(15980145), "Offset is wrong"
+    #at start of last cds segment distance is length of cds segment (180) 
+    assert_equal 180, @AT2G38130_1.get_nt_number_in_cds(15979966), "Offset is wrong"
+    #at end of second cds segment distances is length of first + distance into second (1) = 181
+    assert_equal 181,  @AT2G38130_1.get_nt_number_in_cds(15979866), "Offset is wrong"
+    #ten from end of second cds segment distance is length of first (181) + distance into second (10) = 191
+    assert_equal 191,  @AT2G38130_1.get_nt_number_in_cds(15979856), "Offset is wrong"
+    #last position is length of all cds segments 
+    assert_equal 573, @AT2G38130_1.get_nt_number_in_cds(15978639)
+  end
+  
+  def test_substitution_info
+    
+    ##first residue, + strand
+    result = @AT2G17530_1.substitution_info(7626518, 'a')
+    pp result
+    assert_equal('atg', result[:original_codon])
+    assert_equal('Met', result[:original_residue])
+    assert_equal('atg',result[:mutant_codon])
+    assert_equal('Met', result[:mutant_residue])
+    assert_equal(1, result[:position_in_codon])
+    
+    result = @AT2G17530_1.substitution_info(7626519, 'a')
+    pp result
+    assert_equal('atg', result[:original_codon])
+    assert_equal('Met', result[:original_residue])
+    assert_equal('aag',result[:mutant_codon])
+    assert_equal('Lys', result[:mutant_residue])
+    assert_equal(2, result[:position_in_codon])
+    
+    result = @AT2G17530_1.substitution_info(7626520, 'a')
+    pp result
+    assert_equal('atg', result[:original_codon])
+    assert_equal('Met', result[:original_residue])
+    assert_equal('ata',result[:mutant_codon])
+    assert_equal('Ile', result[:mutant_residue])
+    assert_equal(3, result[:position_in_codon])
+    
+    ##first residue, - strand
+    result = @AT2G38130_1.substitution_info(15980145, 'a')
+    pp result
+    assert_equal('atg', result[:original_codon])
+    assert_equal('Met', result[:original_residue])
+    assert_equal('atg',result[:mutant_codon])
+    assert_equal('Met', result[:mutant_residue])
+    assert_equal(1, result[:position_in_codon])
+
+    result = @AT2G38130_1.substitution_info(15980144, 'a')
+    pp result
+    assert_equal('atg', result[:original_codon])
+    assert_equal('Met', result[:original_residue])
+    assert_equal('aag',result[:mutant_codon])
+    assert_equal('Lys', result[:mutant_residue])
+    assert_equal(2, result[:position_in_codon])
+    
+    result = @AT2G38130_1.substitution_info(15980143, 'a')
+    pp result
+    assert_equal('atg', result[:original_codon])
+    assert_equal('Met', result[:original_residue])
+    assert_equal('ata',result[:mutant_codon])
+    assert_equal('Ile', result[:mutant_residue])
+    assert_equal(3, result[:position_in_codon])    
+    
+    ##third residue second cds segment, + strand -> start pos = 7627317
+    result = @AT2G17530_1.substitution_info(7627317, 'a')
+    pp result
+    assert_equal('gtt', result[:original_codon])
+    assert_equal('Val', result[:original_residue])
+    assert_equal('gat',result[:mutant_codon])
+    assert_equal('Asp', result[:mutant_residue])
+    assert_equal(2, result[:position_in_codon])
+
+    ##third residue second cds segment, - strand -> start pos = 15979753
+    result = @AT2G38130_1.substitution_info(15979753, 'a')
+    pp result
+    assert_equal('cga', result[:original_codon])
+    assert_equal('Arg', result[:original_residue])
+    assert_equal('cga',result[:mutant_codon])
+    assert_equal('Arg', result[:mutant_residue])
+    assert_equal(3, result[:position_in_codon])
+    
+    ##last residue + strand
+    result = @AT2G17530_1.substitution_info(7628624, 'a')
+    pp result
+    assert_equal('tga',result[:original_codon])
+    assert_equal('stop', result[:original_residue])
+    assert_equal('tga',result[:mutant_codon])
+    assert_equal('stop', result[:mutant_residue])  
+    assert_equal(3, result[:position_in_codon]) 
+    
+    result = @AT2G17530_1.substitution_info(7628622, 'a')
+    pp result
+    assert_equal('tga',result[:original_codon])
+    assert_equal('stop', result[:original_residue])
+    assert_equal('aga',result[:mutant_codon])
+    assert_equal('Arg', result[:mutant_residue])  
+    assert_equal(1, result[:position_in_codon]) 
+    
+    ##last residue - strand 
+    result = @AT2G38130_1.substitution_info(15978639, 'a')
+    pp result 
+    assert_equal('taa',result[:original_codon])
+    assert_equal('stop', result[:original_residue])
+    assert_equal('taa',result[:mutant_codon])
+    assert_equal('stop', result[:mutant_residue])  
+    assert_equal(3, result[:position_in_codon])
+    
+    result = @AT2G38130_1.substitution_info(15978641, 'a')
+    pp result 
+    assert_equal('taa',result[:original_codon])
+    assert_equal('stop', result[:original_residue])
+    assert_equal('aaa',result[:mutant_codon])
+    assert_equal('Lys', result[:mutant_residue])  
+    assert_equal(1, result[:position_in_codon])  
+       
+  end
+  
+end
+=begin
+                    :original_codon => codon, 
+                    :original_residue => a || 'stop', 
+                    :mutant_codon => new_codon, 
+                    :mutant_residue =>b || 'stop', 
+                    :position_in_codon => position_in_codon + 1, 
+                    :substitution_type => sub_type
+
+
 class TestBioSynreport < Test::Unit::TestCase
-  should "probably rename this file and start testing for real" do
-    flunk "hey buddy, you should probably rename this file and start testing for real"
+
+  def setup
+    @plus_strand_first_cds = ''
+    @plus_strand_second_cds = ''
+    @minus_strand_first_cds = ''
+    @minus_strand_second_cds = ''
+  end
+
+  def test_nothing
+    assert true
   end
+
 end
+=end

metadata

@@ -1,13 +1,12 @@
 --- !ruby/object:Gem::Specification 
 name: bio-synreport
 version: !ruby/object:Gem::Version 
-  hash: 27
-  prerelease: 
+  prerelease: false
   segments: 
   - 0
   - 1
-  - 0
-  version: 0.1.0
+  - 1
+  version: 0.1.1
 platform: ruby
 authors: 
 - Dan MacLean
@@ -15,84 +14,75 @@ autorequire:
 bindir: bin
 cert_chain: []
 
-date: 2012-11-21 00:00:00 Z
+date: 2013-05-16 00:00:00 +01:00
+default_executable: 
 dependencies: 
 - !ruby/object:Gem::Dependency 
   type: :development
-  prerelease: false
-  requirement: &id001 !ruby/object:Gem::Requirement 
-    none: false
+  version_requirements: &id001 !ruby/object:Gem::Requirement 
     requirements: 
     - - ">="
       - !ruby/object:Gem::Version 
-        hash: 3
         segments: 
         - 0
         version: "0"
-  version_requirements: *id001
   name: shoulda
+  requirement: *id001
+  prerelease: false
 - !ruby/object:Gem::Dependency 
   type: :development
-  prerelease: false
-  requirement: &id002 !ruby/object:Gem::Requirement 
-    none: false
+  version_requirements: &id002 !ruby/object:Gem::Requirement 
     requirements: 
     - - ~>
       - !ruby/object:Gem::Version 
-        hash: 23
         segments: 
         - 1
         - 0
         - 0
         version: 1.0.0
-  version_requirements: *id002
   name: bundler
+  requirement: *id002
+  prerelease: false
 - !ruby/object:Gem::Dependency 
   type: :development
-  prerelease: false
-  requirement: &id003 !ruby/object:Gem::Requirement 
-    none: false
+  version_requirements: &id003 !ruby/object:Gem::Requirement 
     requirements: 
     - - ~>
       - !ruby/object:Gem::Version 
-        hash: 7
         segments: 
         - 1
         - 6
         - 4
         version: 1.6.4
-  version_requirements: *id003
   name: jeweler
+  requirement: *id003
+  prerelease: false
 - !ruby/object:Gem::Dependency 
   type: :development
-  prerelease: false
-  requirement: &id004 !ruby/object:Gem::Requirement 
-    none: false
+  version_requirements: &id004 !ruby/object:Gem::Requirement 
     requirements: 
     - - ">="
       - !ruby/object:Gem::Version 
-        hash: 3
         segments: 
         - 0
         version: "0"
-  version_requirements: *id004
   name: rcov
+  requirement: *id004
+  prerelease: false
 - !ruby/object:Gem::Dependency 
   type: :development
-  prerelease: false
-  requirement: &id005 !ruby/object:Gem::Requirement 
-    none: false
+  version_requirements: &id005 !ruby/object:Gem::Requirement 
     requirements: 
     - - ">="
       - !ruby/object:Gem::Version 
-        hash: 3
         segments: 
         - 1
         - 4
         - 2
         version: 1.4.2
-  version_requirements: *id005
   name: bio
+  requirement: *id005
+  prerelease: false
 description: Takes a GFF and genomic sequence file, constructs CDS and when given a position and alternative base will report whether this change is in a coding region and if it results in a synonymous or non-synonymous mutation.
 email: maclean.daniel@gmail.com
 executables: []
@@ -103,6 +93,7 @@ extra_rdoc_files:
 - LICENSE.txt
 - README.rdoc
 files: 
+- .document
 - Gemfile
 - Gemfile.lock
 - LICENSE.txt
@@ -110,11 +101,15 @@ files:
 - Rakefile
 - VERSION
 - bio-synreport.gemspec
+- examples/test.fa
+- examples/test.gff
 - examples/test.rb
 - lib/bio-synreport.rb
 - lib/bio/utils/bio-synreport.rb
 - test/helper.rb
+- test/sample.gff
 - test/test_bio-synreport.rb
+has_rdoc: true
 homepage: http://github.com/danmaclean/bioruby-synreport
 licenses: 
 - MIT
@@ -124,27 +119,23 @@ rdoc_options: []
 require_paths: 
 - lib
 required_ruby_version: !ruby/object:Gem::Requirement 
-  none: false
   requirements: 
   - - ">="
     - !ruby/object:Gem::Version 
-      hash: 3
       segments: 
       - 0
       version: "0"
 required_rubygems_version: !ruby/object:Gem::Requirement 
-  none: false
   requirements: 
   - - ">="
     - !ruby/object:Gem::Version 
-      hash: 3
       segments: 
       - 0
       version: "0"
 requirements: []
 
 rubyforge_project: 
-rubygems_version: 1.8.11
+rubygems_version: 1.3.6
 signing_key: 
 specification_version: 3
 summary: Reports whether a nucleotide change results in synonymous or non-synonymous mutations