bio-phyloxml 0.9.0

data/.document

@@ -0,0 +1,5 @@
+lib/**/*.rb
+bin/*
+- 
+features/**/*.feature
+LICENSE.txt

data/.travis.yml

@@ -0,0 +1,12 @@
+language: ruby
+rvm:
+  - 1.9.2
+  - 1.9.3
+#  - jruby-19mode # JRuby in 1.9 mode
+#  - rbx-19mode
+#  - 1.8.7
+#  - jruby-18mode # JRuby in 1.8 mode
+#  - rbx-18mode
+
+# uncomment this line if your project needs to run something other than `rake`:
+# script: bundle exec rspec spec

data/Gemfile

@@ -0,0 +1,13 @@
+source "http://rubygems.org"
+# Add dependencies required to use your gem here.
+
+gem "bio", "~> 1.4.2"
+gem "libxml-ruby", "~> 2.3.2"
+
+# Add dependencies to develop your gem here.
+# Include everything needed to run rake, tests, features, etc.
+group :development do
+  gem "rdoc", "~> 3.12"
+  gem "bundler", "~> 1.1.0"
+  gem "jeweler", "~> 1.8.3"
+end

data/LICENSE.txt

@@ -0,0 +1,20 @@
+Copyright (c) 2012 Clayton Wheeler
+
+Permission is hereby granted, free of charge, to any person obtaining
+a copy of this software and associated documentation files (the
+"Software"), to deal in the Software without restriction, including
+without limitation the rights to use, copy, modify, merge, publish,
+distribute, sublicense, and/or sell copies of the Software, and to
+permit persons to whom the Software is furnished to do so, subject to
+the following conditions:
+
+The above copyright notice and this permission notice shall be
+included in all copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.

data/README.md

@@ -0,0 +1,199 @@
+# bio-phyloxml
+
+[![Build Status](https://secure.travis-ci.org/csw/bioruby-phyloxml.png)](http://travis-ci.org/csw/bioruby-phyloxml)
+
+bio-phyloxml is a [phyloXML](http://www.phyloxml.org/) plugin for
+[BioRuby](http://bioruby.open-bio.org/), an open source bioinformatics
+library for Ruby.
+
+phyloXML is an XML language for saving, analyzing and exchanging data
+of annotated phylogenetic trees. The phyloXML parser in BioRuby is
+implemented in Bio::PhyloXML::Parser, and its writer in
+Bio::PhyloXML::Writer.  More information can be found at
+[phyloxml.org](http://www.phyloxml.org).
+
+This phyloXML code has historically been part of the core BioRuby
+[gem](https://github.com/bioruby/bioruby), but has been split into its
+own gem as part of an effort to
+[modularize](http://bioruby.open-bio.org/wiki/Plugins)
+BioRuby. bio-phyloxml and many more plugins are available at
+[biogems.info](http://www.biogems.info/).
+
+This code was originally written by Diana Jaunzeikare during the
+Google Summer of Code 2009 for the
+[Implementing phyloXML support in BioRuby](http://informatics.nescent.org/wiki/Phyloinformatics_Summer_of_Code_2009#Implementing_phyloXML_support_in_BioRuby)
+project with NESCent, mentored by Christian Zmasek et al. For details
+of development, see
+[github.com/latvianlinuxgirl/bioruby](https://github.com/latvianlinuxgirl/bioruby)
+and the BioRuby mailing list archives.
+
+*NOTE:* this is currently in the repackaging process and is not yet
+ released! Production users should use the phyloXML support provided
+ with BioRuby for the time being.
+
+## Requirements
+
+bio-phyloxml uses [libxml-ruby](http://xml4r.github.com/libxml-ruby/),
+which requires several C libraries and their headers to be installed:
+ * `zlib`
+ * `libiconv`
+ * `libxml`
+ 
+With these installed, the `bio` and `libxml-ruby` gems should be installed
+
+```sh
+gem install -r bio libxml-ruby
+```
+
+For more information see the
+[libxml installer page](http://libxml.rubyforge.org/install.xml) and
+the [BioRuby installation page](http://bioruby.open-bio.org/wiki/Installation).
+
+
+## Installation
+
+```sh
+gem install bio-phyloxml
+```
+
+## Migration
+
+Users who were previously using the phyloXML support in the core
+BioRuby gem should be able to migrate to using this gem very
+easily. Simply install the `bio-phyloxml` gem as described below, and
+add `require 'bio-phyloxml'` to the relevant application code.
+
+## Usage
+
+```ruby
+require 'bio-phyloxml'
+```
+
+### Parsing a file
+
+```ruby
+require 'bio-phyloxml'
+
+# Create new phyloxml parser
+phyloxml = Bio::PhyloXML::Parser.open('example.xml')
+
+# Print the names of all trees in the file
+phyloxml.each do |tree|
+  puts tree.name
+end
+```
+
+If there are several trees in the file, you can access the one you wish by specifying its index:
+
+```ruby
+tree = phyloxml[3]
+```
+You can use all Bio::Tree methods on the tree, since PhyloXML::Tree inherits from Bio::Tree. For example, 
+
+```ruby
+tree.leaves.each do |node|
+ puts node.name
+end
+```
+
+PhyloXML files can hold additional information besides phylogenies at the end of the file. This info can be accessed through the 'other' array of the parser object.
+
+```ruby
+phyloxml = Bio::PhyloXML::Parser.open('example.xml')
+while tree = phyloxml.next_tree
+  # do stuff with trees
+end 
+
+puts phyloxml.other
+```
+
+### Writing a file
+
+```ruby
+# Create new phyloxml writer
+writer = Bio::PhyloXML::Writer.new('tree.xml')
+
+# Write tree to the file tree.xml
+writer.write(tree1) 
+
+# Add another tree to the file
+writer.write(tree2)
+```
+
+### Retrieving data
+
+Here is an example of how to retrieve the scientific name of the clades included in each tree.
+
+```ruby
+require 'bio-phyloxml'
+
+phyloxml = Bio::PhyloXML::Parser.open('ncbi_taxonomy_mollusca.xml')
+phyloxml.each do |tree|
+  tree.each_node do |node|
+    print "Scientific name: ", node.taxonomies[0].scientific_name, "\n"
+  end
+end
+```
+
+### Retrieving 'other' data
+
+```ruby
+require 'bio'
+
+phyloxml = Bio::PhyloXML::Parser.open('phyloxml_examples.xml')
+while tree = phyloxml.next_tree
+ #do something with the trees
+end
+
+p phyloxml.other
+puts "\n"
+#=> output is an object representation
+
+#Print in a readable way
+puts phyloxml.other[0].to_xml, "\n"
+#=>:
+#
+#<align:alignment xmlns:align="http://example.org/align">
+#  <seq name="A">acgtcgcggcccgtggaagtcctctcct</seq>
+#  <seq name="B">aggtcgcggcctgtggaagtcctctcct</seq>
+#  <seq name="C">taaatcgc--cccgtgg-agtccc-cct</seq>
+#</align:alignment>
+
+#Once we know whats there, lets output just sequences
+phyloxml.other[0].children.each do |node|
+ puts node.value
+end
+#=>
+#
+#acgtcgcggcccgtggaagtcctctcct
+#aggtcgcggcctgtggaagtcctctcct
+#taaatcgc--cccgtgg-agtccc-cct
+```
+
+The API doc is online. (TODO: generate and link) For more code
+examples see the test files in the source tree.
+
+## Project home page
+
+Information on the source tree, documentation, examples, issues and
+how to contribute, see
+
+  http://github.com/csw/bioruby-phyloxml
+
+The BioRuby community is on IRC server: irc.freenode.org, channel: #bioruby.
+
+## Cite
+
+If you use this software, please cite one of
+  
+* [BioRuby: bioinformatics software for the Ruby programming language](http://dx.doi.org/10.1093/bioinformatics/btq475)
+* [Biogem: an effective tool-based approach for scaling up open source software development in bioinformatics](http://dx.doi.org/10.1093/bioinformatics/bts080)
+
+## Biogems.info
+
+This Biogem is published at [#bio-phyloxml](http://biogems.info/index.html)
+
+## Copyright
+
+Copyright (c) 2009 Diana Jaunzeikare. See LICENSE.txt for further details.
+

data/README.rdoc

@@ -0,0 +1,48 @@
+= bio-phyloxml
+
+{<img
+src="https://secure.travis-ci.org/csw/bioruby-phyloxml.png"
+/>}[http://travis-ci.org/#!/csw/bioruby-phyloxml]
+
+Full description goes here
+
+Note: this software is under active development!
+
+== Installation
+
+        gem install bio-phyloxml
+
+== Usage
+
+== Developers
+
+To use the library 
+
+        require 'bio-phyloxml'
+
+The API doc is online. For more code examples see also the test files in
+the source tree.
+        
+== Project home page
+
+Information on the source tree, documentation, issues and how to contribute, see
+
+  http://github.com/csw/bioruby-phyloxml
+
+The BioRuby community is on IRC server: irc.freenode.org, channel: #bioruby.
+
+== Cite
+
+  If you use this software, please cite one of
+ 
+* [BioRuby: bioinformatics software for the Ruby programming language](http://dx.doi.org/10.1093/bioinformatics/btq475)
+* [Biogem: an effective tool-based approach for scaling up open source software development in bioinformatics](http://dx.doi.org/10.1093/bioinformatics/bts080)
+
+== Biogems.info
+
+This Biogem is published at http://biogems.info/index.html#bio-phyloxml
+
+== Copyright
+
+Copyright (c) 2012 Clayton Wheeler. See LICENSE.txt for further details.
+

data/Rakefile

@@ -0,0 +1,45 @@
+# encoding: utf-8
+
+require 'rubygems'
+require 'bundler'
+begin
+  Bundler.setup(:default, :development)
+rescue Bundler::BundlerError => e
+  $stderr.puts e.message
+  $stderr.puts "Run `bundle install` to install missing gems"
+  exit e.status_code
+end
+require 'rake'
+
+require 'jeweler'
+Jeweler::Tasks.new do |gem|
+  # gem is a Gem::Specification... see http://docs.rubygems.org/read/chapter/20 for more options
+  gem.name = "bio-phyloxml"
+  gem.homepage = "http://github.com/csw/bioruby-phyloxml"
+  gem.license = "MIT"
+  gem.summary = %Q{PhyloXML plugin for BioRuby}
+  gem.description = %Q{Provides PhyloXML support for BioRuby.}
+  gem.email = "cswh@umich.edu"
+  gem.authors = ["Diana Jaunzeikare", "Clayton Wheeler"]
+  # dependencies defined in Gemfile
+end
+Jeweler::RubygemsDotOrgTasks.new
+
+require 'rake/testtask'
+Rake::TestTask.new(:test) do |test|
+  test.libs << 'lib' << 'test'
+  test.pattern = 'test/**/test_*.rb'
+  test.verbose = true
+end
+
+task :default => :test
+
+require 'rdoc/task'
+Rake::RDocTask.new do |rdoc|
+  version = File.exist?('VERSION') ? File.read('VERSION') : ""
+
+  rdoc.rdoc_dir = 'rdoc'
+  rdoc.title = "bio-phyloxml #{version}"
+  rdoc.rdoc_files.include('README*')
+  rdoc.rdoc_files.include('lib/**/*.rb')
+end

data/VERSION

@@ -0,0 +1 @@
+0.9.0

data/lib/bio-phyloxml.rb

@@ -0,0 +1,12 @@
+# Please require your code below, respecting the naming conventions in the
+# bioruby directory tree.
+#
+# For example, say you have a plugin named bio-plugin, the only uncommented
+# line in this file would be 
+#
+#   require 'bio/bio-plugin/plugin'
+#
+# In this file only require other files. Avoid other source code.
+
+require 'bio'
+require 'bio/phyloxml'

data/lib/bio/phyloxml.rb

@@ -0,0 +1,3 @@
+require 'bio/phyloxml/parser'
+require 'bio/phyloxml/elements'
+require 'bio/phyloxml/writer'

data/lib/bio/phyloxml/elements.rb

@@ -0,0 +1,1166 @@
+#
+# = bio/db/phyloxml_elements.rb - PhyloXML Element classes
+#
+# Copyright::   Copyright (C) 2009
+#               Diana Jaunzeikare <latvianlinuxgirl@gmail.com>
+# License::     The Ruby License
+#
+# $Id:$
+#
+# == Description
+#
+# This file containts the classes to represent PhyloXML elements.
+#
+# == References
+#
+# * http://www.phyloxml.org
+#
+# * https://www.nescent.org/wg_phyloinformatics/PhyloSoC:PhyloXML_support_in_BioRuby
+
+require 'bio/tree'
+require 'bio/sequence'
+require 'bio/reference'
+
+require 'libxml'
+
+module Bio
+
+   # This is general Taxonomy class.
+
+  class Taxonomy
+    #pattern = [a-zA-Z0-9_]{2,10} Can refer to any code/abbreviation/mnemonic, such as Bsu for Bacillus subtilis.
+    attr_accessor :code
+
+    # String.
+    attr_accessor :scientific_name
+    # An array of strings
+    attr_accessor :common_names
+
+    # value comes from list: domain kingdom, subkingdom, branch, infrakingdom,
+    # superphylum, phylum, subphylum, infraphylum, microphylum, superdivision,
+    # division, subdivision, infradivision, superclass, class, subclass,
+    # infraclass, superlegion, legion, sublegion, infralegion, supercohort,
+    # cohort, subcohort, infracohort, superorder, order, suborder,
+    # superfamily, family, subfamily, supertribe, tribe, subtribe, infratribe,
+    # genus, subgenus, superspecies, species, subspecies, variety, subvariety,
+    # form, subform, cultivar, unknown, other
+    attr_accessor :rank
+
+    # is used to keep the authority, such as 'J. G. Cooper, 1863', associated with the 'scientific_name'.
+    attr_accessor :authority
+
+    # An array of strings. Holds synonyms for scientific names or common names.
+    attr_accessor :synonyms
+
+
+    def initialize
+      @common_names = []
+      @synonyms = []
+    end
+  end
+
+module PhyloXML
+
+  
+  # Taxonomy class
+  class Taxonomy < Bio::Taxonomy
+    # String. Unique identifier of a taxon.
+    attr_accessor :taxonomy_id
+    #Used to link other elements to a taxonomy (on the xml-level)
+    attr_accessor :id_source
+    # Uri object
+    attr_accessor :uri
+
+    # Array of Other objects. Used to save additional information from other than
+    # PhyloXML namspace.
+    attr_accessor :other
+
+    def initialize
+      super
+      @other = []
+    end
+
+    # Converts elements to xml representation. Called by PhyloXML::Writer class.
+    def to_xml
+      taxonomy = LibXML::XML::Node.new('taxonomy')
+      taxonomy["type"] = @type if @type != nil
+      taxonomy["id_source"] = @id_source if @id_source != nil
+
+      PhyloXML::Writer.generate_xml(taxonomy, self, [[:complex, 'id', @taxonomy_id],
+        [:pattern, 'code', @code, Regexp.new("^[a-zA-Z0-9_]{2,10}$")],
+        [:simple, 'scientific_name', @scientific_name],
+        [:simple, 'authority', @authority],
+        [:simplearr, 'common_name', @common_names],
+        [:simplearr, 'synonym', @synonyms],
+        [:simple, 'rank', @rank],
+        [:complex, 'uri',@uri]])
+        #@todo anything else
+
+
+      return taxonomy
+    end
+
+  end
+
+  # Object to hold one phylogeny element (and its subelements.) Extended version of Bio::Tree.
+  class Tree < Bio::Tree
+    # String. Name of tree (name subelement of phylogeny element).
+    attr_accessor :name
+
+    # Id object.
+    attr_accessor :phylogeny_id
+
+    # String. Description of tree.
+    attr_accessor :description
+   
+    # Boolean. Can be used to indicate that the phylogeny is not allowed to be rooted differently (i.e. because it is associated with root dependent data, such as gene duplications).
+    attr_accessor :rerootable
+
+    # Boolean. Required element.
+    attr_accessor  :rooted
+
+    # Array of Property object. Allows for typed and referenced properties from external resources to be attached.
+    attr_accessor :properties
+
+    # CladeRelation object. This is used to express a typed relationship between two clades. For example it could be used to describe multiple parents of a clade.
+    attr_accessor :clade_relations
+
+    # SequenceRelation object. This is used to express a typed relationship between two sequences. For example it could be used to describe an orthology.
+    attr_accessor :sequence_relations
+
+    # Array of confidence object
+    attr_accessor :confidences
+
+    # String.
+    attr_accessor :branch_length_unit
+
+    # String. Indicate the type of phylogeny (i.e. 'gene tree').
+    attr_accessor :type
+
+    # String. Date
+    attr_accessor :date
+
+    # Array of Other objects. Used to save additional information from other than
+    # PhyloXML namspace.
+    attr_accessor :other
+
+   def initialize
+     super
+     @sequence_relations = []
+     @clade_relations = []
+     @confidences = []
+     @properties = []
+     @other = []
+   end
+
+ end
+
+
+  # == Description
+  # Class to hold clade element of phyloXML.
+  class Node
+
+    # Events at the root node of a clade (e.g. one gene duplication).
+    attr_accessor :events
+
+    # String. Used to link other elements to a clade (node) (on the xml-level).
+    attr_accessor :id_source
+
+    # String. Name of the node.
+    attr_accessor :name
+
+    # Float. Branch width for this node (including parent branch). Applies for the whole clade unless overwritten in sub-clades.
+    attr_reader :width
+
+    def width=(str)
+      @width = str.to_f
+    end
+
+    # Array of Taxonomy objects. Describes taxonomic information for a clade.
+    attr_accessor :taxonomies
+
+    # Array of Confidence objects. Indicates the support for a clade/parent branch.
+    attr_accessor :confidences
+
+    # BranchColor object. Apply for the whole clade unless overwritten in sub-clade.
+    attr_accessor :color
+
+    # Id object
+    attr_accessor :node_id
+
+    # Array of Sequence objects. Represents a molecular sequence (Protein, DNA, RNA) associated with a node.
+    attr_accessor :sequences
+
+    # BinaryCharacters object. The names and/or counts of binary characters present, gained, and lost at the root of a clade.
+    attr_accessor :binary_characters
+
+    # Array of Distribution objects. The geographic distribution of the items of a clade (species, sequences), intended for phylogeographic applications.
+    attr_accessor :distributions
+
+    # Date object. A date associated with a clade/node.
+    attr_accessor :date
+
+    #Array of Reference objects. A literature reference for a clade.
+    attr_accessor :references
+
+    #An array of Property objects, for example depth for sea animals.
+    attr_accessor :properties
+
+    # Array of Other objects. Used to save additional information from other than
+    # PhyloXML namspace.
+    attr_accessor :other
+
+    def initialize
+      @confidences = []
+      @sequences = []
+      @taxonomies = []
+      @distributions = []
+      @references = []
+      @properties = []
+      @other = []
+    end
+
+
+    # Converts to a Bio::Tree::Node object. If it contains several taxonomies 
+    # Bio::Tree::Node#scientific name will get the scientific name of the first 
+    # taxonomy.
+    # 
+    # If there are several confidence values, the first with bootstrap type will 
+    # be returned as Bio::Tree::Node#bootstrap
+    #
+    # tree = phyloxmlparser.next_tree
+    #
+    # node = tree.get_node_by_name("A").to_biotreenode
+    #
+    # ---
+    # *Returns*:: Bio::Tree::Node
+    def to_biotreenode
+      node = Bio::Tree::Node.new
+      node.name = @name
+      node.scientific_name = @taxonomies[0].scientific_name if not @taxonomies.empty?
+      #@todo what if there are more?
+      node.taxonomy_id = @taxonomies[0].taxononmy_id if @taxonomies[0] != nil
+
+      if not @confidences.empty?
+        @confidences.each do |confidence|
+          if confidence.type == "bootstrap"
+            node.bootstrap = confidence.value
+            break
+          end
+        end
+      end      
+      return node
+    end
+
+    # Extracts the relevant information from node (specifically taxonomy and
+    # sequence) to create Bio::Sequence object. Node can have several sequences,
+    # so parameter to this method is to specify which sequence to extract. 
+    #
+    # ---
+    # *Returns*:: Bio::Sequence
+    def extract_biosequence(seq_i=0)
+
+      seq = @sequences[seq_i].to_biosequence
+      seq.classification = []
+      @taxonomies.each do |t|
+        seq.classification << t.scientific_name
+        if t.rank == "species"
+          seq.species = t.scientific_name
+        end
+      end
+
+      #seq.division => .. http://www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_2
+      # It doesn't seem there is anything in PhyloXML corresponding to this.
+
+      return seq
+    end
+
+    # Converts elements to xml representation. Called by PhyloXML::Writer class.
+    def to_xml(branch_length,  write_branch_length_as_subelement)
+      clade = LibXML::XML::Node.new('clade')
+      
+      PhyloXML::Writer.generate_xml(clade, self, [[:simple, 'name', @name]])
+
+      if branch_length != nil       
+        if write_branch_length_as_subelement
+          clade << LibXML::XML::Node.new('branch_length', branch_length.to_s)
+        else
+          clade["branch_length"] = branch_length.to_s
+        end
+      end
+
+      #generate all elements, except clade
+      PhyloXML::Writer.generate_xml(clade, self, [
+          [:attr, "id_source"],
+          [:objarr, 'confidence', 'confidences'],
+          [:simple, 'width', @width],
+          [:complex, 'branch_color', @branch_color],
+          [:simple, 'node_id', @node_id],
+          [:objarr, 'taxonomy', 'taxonomies'],
+          [:objarr, 'sequence', 'sequences'],
+          [:complex, 'events', @events],
+          [:complex, 'binary_characters', @binary_characters],          
+          [:objarr, 'distribution', 'distributions'],
+          [:complex, 'date', @date],          
+          [:objarr, 'reference', 'references'],
+          [:objarr, 'propery', 'properties']])
+     
+      return clade
+    end
+
+  end #Node
+
+  # == Description
+  # Events at the root node of a clade (e.g. one gene duplication).
+  class Events
+    #value comes from list: transfer, fusion, speciation_or_duplication, other, mixed, unassigned
+    attr_accessor :type
+
+    # Integer
+    attr_reader :duplications, :speciations, :losses
+
+    # Confidence object
+    attr_reader :confidence
+
+    def confidence=(type, value)
+      @confidence = Confidence.new(type, value)
+    end
+
+    def confidence=(conf)
+      @confidence = conf
+    end
+
+    def duplications=(str)
+      @duplications = str.to_i
+    end
+
+    def losses=(str)
+      @losses = str.to_i
+    end
+
+    def speciations=(str)
+      @speciations=str.to_i
+    end
+
+    def type=(str)
+      @type = str
+      #@todo add unit test for this
+      if not ['transfer','fusion','speciation_or_duplication','other','mixed', 'unassigned'].include?(str)
+        raise "Warning #{str} is not one of the allowed values"
+      end
+    end
+
+    # Converts elements to xml representation. Called by PhyloXML::Writer class.
+    def to_xml
+      #@todo add unit test
+      events = LibXML::XML::Node.new('events')
+      PhyloXML::Writer.generate_xml(events, self, [
+        [:simple, 'type', @type],
+        [:simple, 'duplications', @duplications],
+        [:simple, 'speciations', @speciations],
+        [:simple, 'losses', @losses],
+        [:complex, 'confidence', @confidence]])
+      return events
+    end
+
+  end
+
+    # A general purpose confidence element. For example this can be used to express
+    # the bootstrap support value of a clade (in which case the 'type' attribute
+    # is 'bootstrap').
+    class Confidence
+      # String. The type of confidence measure, for example, bootstrap.
+      attr_accessor :type
+      # Float. The value of confidence measure.
+      attr_accessor :value
+
+      def initialize(type, value)
+        @type = type
+        @value = value.to_f
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        if @type == nil
+          raise "Type is a required attribute for confidence."
+        else
+          confidence = LibXML::XML::Node.new('confidence', @value.to_s)
+          confidence["type"] = @type          
+          return confidence
+        end
+      end
+    end
+
+    # == Description
+    #
+    # The geographic distribution of the items of a clade (species, sequences),
+    # intended for phylogeographic applications. 
+    class Distribution
+      # String. Free text description of location.
+      attr_accessor :desc
+      # Array of Point objects. Holds coordinates of the location.
+      attr_accessor :points
+      # Array of Polygon objects.
+      attr_accessor :polygons
+
+      def initialize
+        @points = []
+        @polygons = []
+      end
+
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        distr = LibXML::XML::Node.new('distribution')
+        PhyloXML::Writer.generate_xml(distr, self, [
+            [:simple, 'desc', @desc],
+            [:objarr, 'point', 'points'],
+            [:objarr, 'polygon', 'polygons']])
+        return distr
+      end
+      
+    end #Distribution class
+
+
+    # == Description
+    #
+    # The coordinates of a point with an optional altitude. Required attribute
+    # 'geodetic_datum' is used to indicate the geodetic datum (also called
+    # 'map datum'), for example Google's KML uses 'WGS84'.
+    class Point
+      # Float. Latitude
+      attr_accessor :lat
+
+      # Float. Longitute
+      attr_accessor :long
+      
+      # Float. Altitude
+      attr_accessor :alt
+
+      # String. Altitude unit.
+      attr_accessor :alt_unit
+
+      # Geodedic datum / map datum
+      attr_accessor :geodetic_datum
+
+      def lat=(str)
+        @lat = str.to_f unless str.nil?
+      end
+
+      def long=(str)
+        @long = str.to_f unless str.nil?
+      end
+
+      def alt=(str)
+        @alt = str.to_f unless str.nil?
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        raise "Geodedic datum is a required attribute of Point element." if @geodetic_datum.nil?
+
+        p = LibXML::XML::Node.new('point')
+        p["geodetic_datum"] = @geodetic_datum
+        p["alt_unit"] = @alt_unit if @alt_unit != nil
+        PhyloXML::Writer.generate_xml(p, self, [
+            [:simple, 'lat', @lat],
+            [:simple, 'long', @long],
+            [:simple, 'alt', @alt]])
+        return p
+        #@todo check if characters are correctly generated, like Zuric
+      end
+
+    end
+
+
+    # == Description
+    #
+    # A polygon defined by a list of Points objects.
+    class Polygon
+      # Array of Point objects.
+      attr_accessor :points
+
+      def initialize
+        @points = []
+      end
+
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        if @points.length > 2          
+          pol = LibXML::XML::Node.new('polygon')
+          @points.each do |p|
+            pol << p.to_xml
+          end
+          return pol
+        end
+      end
+
+
+    end
+
+    # == Description
+    # Element Sequence is used to represent a molecular sequence (Protein, DNA,
+    # RNA) associated with a node.
+    class Sequence
+      # Type of sequence (rna, dna, protein)
+      attr_accessor :type
+
+      # Full name (e.g. muscle Actin )
+      attr_accessor :name
+
+      # String. Used to link with other elements.
+      attr_accessor :id_source
+
+      # String. One intended use for 'id_ref' is to link a sequence to a taxonomy
+      # (via the taxonomy's 'id_source') in the case of multiple sequences and taxonomies per node.
+      attr_accessor :id_ref
+
+      # short (maximal ten characters) symbol of the sequence (e.g. 'ACTM')
+      attr_accessor :symbol
+      # Accession object. Holds source and identifier for the sequence.
+      attr_accessor :accession
+      # String. Location of a sequence on a genome/chromosome
+      attr_accessor :location
+      # String. The actual sequence is stored here.
+      attr_reader :mol_seq
+
+      # Boolean. used to indicated that this molecular sequence is aligned with
+      # all other sequences in the same phylogeny for which 'is aligned' is true
+      # as well (which, in most cases, means that gaps were introduced, and that
+      # all sequences for which 'is aligned' is true must have the same length)
+      attr_reader :is_aligned
+      
+      # Uri object
+      attr_accessor :uri
+      # Array of Annotation objects. Annotations of molecular sequence.
+      attr_accessor :annotations
+      # DomainArchitecture object. Describes domain architecture of a protein.
+      attr_accessor :domain_architecture
+
+      # Array of Other objects. Used to save additional information from other than
+      # PhyloXML namspace.
+      attr_accessor :other
+
+      def initialize
+        @annotations = []
+        @other = []
+      end
+
+      def is_aligned=(str)
+        if str=='true'
+          @is_aligned=true
+        elsif str=='false'
+          @is_aligned = false
+        else
+          @is_aligned = nil
+        end
+      end
+
+      def is_aligned?
+        @is_aligned
+      end
+
+      def mol_seq=(str)
+        if str =~ /^[a-zA-Z\.\-\?\*_]+$/
+          @mol_seq = str
+        else
+          raise "mol_seq element of Sequence does not follow the pattern."
+        end
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        
+        seq = LibXML::XML::Node.new('sequence')
+        if @type != nil
+          if ["dna", "rna", "protein"].include?(@type)
+            seq["type"] = @type
+          else 
+            raise "Type attribute of Sequence has to be one of dna, rna or a."
+          end
+        end
+        
+        PhyloXML::Writer.generate_xml(seq, self, [
+            [:attr, 'id_source'],
+            [:attr, 'id_ref'],
+            [:pattern, 'symbol', @symbol, Regexp.new("^\\S{1,10}$")],
+            [:complex, 'accession', @accession],
+            [:simple, 'name', @name],
+            [:simple, 'location', @location]])
+
+        if @mol_seq != nil
+          molseq = LibXML::XML::Node.new('mol_seq', @mol_seq)
+          molseq["is_aligned"] = @is_aligned.to_s if @is_aligned != nil
+          seq << molseq
+        end
+
+        PhyloXML::Writer.generate_xml(seq, self, [
+            #[:pattern, 'mol_seq', @mol_seq, Regexp.new("^[a-zA-Z\.\-\?\*_]+$")],
+            [:complex, 'uri', @uri],
+            [:objarr, 'annotation', 'annotations'],
+            [:complex, 'domain_architecture', @domain_architecture]])
+            #@todo test domain_architecture
+        #any
+        return seq
+      end
+
+      # converts Bio::PhyloXML:Sequence to Bio::Sequence object.
+      # ---
+      # *Returns*:: Bio::Sequence
+      def to_biosequence
+        #type is not a required attribute in phyloxml (nor any other Sequence
+        #element) it might not hold any value, so we will not check what type it is.
+        seq = Bio::Sequence.auto(@mol_seq)
+
+        seq.id_namespace = @accession.source
+        seq.entry_id = @accession.value
+        # seq.primary_accession = @accession.value could be this
+        seq.definition = @name
+        #seq.comments = @name //this one?
+        if @uri != nil
+          h = {'url' => @uri.uri,
+            'title' => @uri.desc }
+          ref = Bio::Reference.new(h)
+          seq.references << ref
+        end
+        seq.molecule_type = 'RNA' if @type == 'rna'
+        seq.molecule_type = 'DNA' if @type == 'dna'
+
+        #@todo deal with the properties. There might be properties which look
+        #like bio sequence attributes or features
+        return seq
+      end
+
+    end
+
+    # == Description
+    # Element Accession is used to capture the local part in a sequence
+    # identifier.
+    class Accession
+      #String. Source of the accession id. Example: "UniProtKB"
+      attr_accessor :source
+
+      #String. Value of the accession id. Example: "P17304"
+      attr_accessor :value
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        raise "Source attribute is required for Accession object." if @source == nil
+        accession = LibXML::XML::Node.new('accession', @value)
+        accession['source'] = @source
+        return accession
+      end
+
+    end
+
+    # A uniform resource identifier. In general, this is expected to be an URL
+    # (for example, to link to an image on a website, in which case the 'type'
+    # attribute might be 'image' and 'desc' might be  'image of a California
+    # sea hare')
+    class Uri
+      # String. Description of the uri. For example, image of a California sea hare'
+      attr_accessor :desc
+      # String. For example, image.
+      attr_accessor :type
+      # String. URL of the resource.
+      attr_accessor :uri 
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml        
+        if @uri != nil
+          xml_node = LibXML::XML::Node.new('uri', @uri)
+          Writer.generate_xml(xml_node, self, [
+            [:attr, 'desc'],
+            [:attr, 'type']])
+          return xml_node
+        end
+      end
+    end
+
+    # == Description
+    #
+    # The annotation of a molecular sequence. It is recommended to annotate by
+    # using the optional 'ref' attribute (some examples of acceptable values
+    # for the ref attribute: 'GO:0008270', 'KEGG:Tetrachloroethene degradation',
+    #  'EC:1.1.1.1').
+    class Annotation
+      # String. For example, 'GO:0008270', 'KEGG:Tetrachloroethene degradation',
+      # 'EC:1.1.1.1'
+      attr_accessor :ref
+      # String
+      attr_accessor :source
+      # String. evidence for a annotation as free text (e.g. 'experimental')
+      attr_accessor :evidence
+      # String. Type of the annotation.
+      attr_accessor :type
+      # String. Free text description. 
+      attr_accessor :desc
+      # Confidence object. Type and value of support for a annotation.
+      attr_accessor :confidence
+      # Array of Property objects. Allows for further, typed and referenced
+      # annotations from external resources
+      attr_accessor :properties
+      # Uri object.
+      attr_accessor :uri
+
+      def initialize
+        #@todo add unit test for this, since didn't break anything when changed from property to properties
+        @properties = []
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class. 
+      def to_xml
+        annot = LibXML::XML::Node.new('annotation')
+        annot["ref"] = @ref if @ref != nil
+        PhyloXML::Writer.generate_xml(annot, self, [[:simple, 'desc', @desc],
+          [:complex, 'confidence', @confidence],
+          [:objarr, 'property', 'properties'],
+          [:complex, 'uri', @uri]])
+        return annot
+      end
+    end
+
+    class Id
+      # The provider of Id, for example, NCBI.
+      attr_accessor :provider
+      # The value of Id. 
+      attr_accessor :value
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        xml_node = LibXML::XML::Node.new('id', @value)
+        xml_node["provider"] = @provider if @provider != nil
+        return xml_node
+      end
+    end
+
+    # == Description
+    # This indicates the color of a node when rendered (the color applies
+    # to the whole node and its children unless overwritten by the
+    # color(s) of sub clades).
+    class BranchColor
+      #Integer
+      attr_reader :red, :green, :blue
+
+      def red=(str)
+        @red = str.to_i
+      end
+
+      def green=(str)
+        @green = str.to_i
+      end
+
+      def blue=(str)
+        @blue = str.to_i
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        #@todo add unit test
+        if @red == nil
+          raise "Subelement red of BranchColor element should not be nil"
+        elsif @green == nil
+          raise "Subelement green of BranchColor element should not be nil"
+        elsif @blue == nil
+          raise "Subelement blue of BranchColor element should not be nil"
+        end
+
+        c = LibXML::XML::Node.new('branch_color')
+        PhyloXML::Writer.generate_xml(c, self, [
+            [:simple, 'red', @red],
+            [:simple, 'green', @green],
+            [:simple, 'blue', @blue]])
+        return c
+      end
+
+    end
+
+    # == Description
+    # A date associated with a clade/node. Its value can be numerical by
+    # using the 'value' element and/or free text with the 'desc' element'
+    # (e.g. 'Silurian'). If a numerical value is used, it is recommended to
+    # employ the 'unit' attribute to indicate the type of the numerical
+    # value (e.g. 'mya' for 'million years ago').
+    class Date
+      # String. Units in which value is stored.
+      attr_accessor :unit
+
+      # Free text description of the date.
+      attr_accessor :desc
+
+      # Integer. Minimum and maximum of the value.
+      attr_reader :minimum, :maximum
+
+      # Integer. Value of the date.
+      attr_reader :value
+
+      def minimum=(str)
+        @minimum = str.to_i
+      end
+
+      def maximum=(str)
+        @maximum = str.to_i
+      end
+
+      def value= (str)
+        @value = str.to_i
+      end
+
+      # Returns value + unit, for exampe "7 mya"
+      def to_s
+        return "#{value} #{unit}"
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        date = LibXML::XML::Node.new('date')
+        PhyloXML::Writer.generate_xml(date, self, [
+            [:attr, 'unit'],
+            [:simple, 'desc', @desc],
+            [:simple, 'value', @value],
+            [:simple, 'minimum', @minimum],
+            [:simple, 'maximum', @maximum]])
+        return date
+      end
+
+    end
+
+    # == Description
+    # This is used describe the domain architecture of a protein. Attribute
+    # 'length' is the total length of the protein
+    class DomainArchitecture
+      # Integer. Total length of the protein
+      attr_accessor :length
+
+      # Array of ProteinDomain objects.
+      attr_reader :domains
+
+      def length=(str)
+        @length = str.to_i
+      end
+
+      def initialize
+        @domains = []
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        xml_node = LibXML::XML::Node.new('domain_architecture')
+        PhyloXML::Writer.generate_xml(xml_node, self,[
+              [:attr, 'length'],
+              [:objarr, 'domain', 'domains']])
+        return xml_node
+      end
+    end
+
+
+    # == Description
+    # To represent an individual domain in a domain architecture. The
+    # name/unique identifier is described via the 'id' attribute.
+    class ProteinDomain
+      #Float, for example to store E-values    4.7E-14
+      attr_accessor :confidence
+      
+      # String
+      attr_accessor :id, :value
+
+      # Integer. Beginning of the domain.
+      attr_reader :from
+
+      # Integer. End of the domain.
+      attr_reader :to
+
+      def from=(str)
+        @from = str.to_i
+      end
+
+      def to=(str)
+        @to = str.to_i
+      end
+      
+      def confidence=(str)
+        @confidence = str.to_f
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        if @from == nil
+          raise "from attribute of ProteinDomain class is required."
+        elsif @to == nil
+          raise "to attribute of ProteinDomain class is required."
+        else
+          xml_node = LibXML::XML::Node.new('domain', @value)
+          xml_node["from"] = @from.to_s
+          xml_node["to"] = @to.to_s
+          xml_node["id"] = @id if @id != nil
+          xml_node["confidence"] = @confidence.to_s
+
+          return xml_node
+        end
+
+      end
+
+    end
+
+
+    #Property allows for typed and referenced properties from external resources
+    #to be attached to 'Phylogeny', 'Clade', and 'Annotation'. The value of a
+    #property is its mixed (free text) content. Attribute 'datatype' indicates
+    #the type of a property and is limited to xsd-datatypes (e.g. 'xsd:string',
+    #'xsd:boolean', 'xsd:integer', 'xsd:decimal', 'xsd:float', 'xsd:double',
+    #'xsd:date', 'xsd:anyURI'). Attribute 'applies_to' indicates the item to
+    #which a property applies to (e.g. 'node' for the parent node of a clade,
+    #'parent_branch' for the parent branch of a clade). Attribute 'id_ref' allows
+    #to attached a property specifically to one element (on the xml-level).
+    #Optional attribute 'unit' is used to indicate the unit of the property.
+    #An example: <property datatype="xsd:integer" ref="NOAA:depth" applies_to="clade" unit="METRIC:m"> 200 </property>
+    class Property
+      # String
+      attr_accessor :ref, :unit, :id_ref, :value
+
+      # String
+      attr_reader :datatype, :applies_to
+
+      def datatype=(str)
+         #@todo add unit test or maybe remove, if assume that xml is valid.
+        unless ['xsd:string','xsd:boolean','xsd:decimal','xsd:float','xsd:double',
+            'xsd:duration','xsd:dateTime','xsd:time','xsd:date','xsd:gYearMonth',
+            'xsd:gYear','xsd:gMonthDay','xsd:gDay','xsd:gMonth','xsd:hexBinary',
+            'xsd:base64Binary','xsd:anyURI','xsd:normalizedString','xsd:token',
+            'xsd:integer','xsd:nonPositiveInteger','xsd:negativeInteger',
+            'xsd:long','xsd:int','xsd:short','xsd:byte','xsd:nonNegativeInteger',
+            'xsd:unsignedLong','xsd:unsignedInt','xsd:unsignedShort',
+            'xsd:unsignedByte','xsd:positiveInteger'].include?(str)
+          raise "Warning: #{str} is not in the list of allowed values."
+        end
+        @datatype = str
+      end
+
+      def applies_to=(str)
+        unless ['phylogeny','clade','node','annotation','parent_branch','other'].include?(str)
+          puts "Warning: #{str} is not in the list of allowed values."
+        end
+        @applies_to = str
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        #@todo  write unit test for this
+        raise "ref is an required element of property"  if @ref.nil?
+        raise "datatype is an required element of property" if @datatype.nil?
+        raise "applies_to is an required element of property" if @applies_to.nil?
+
+        property = LibXML::XML::Node.new('property')
+        Writer.generate_xml(property, self, [
+            [:attr, 'ref'],
+            [:attr, 'unit'],
+            [:attr, 'datatype'],
+            [:attr, 'applies_to'],
+            [:attr, 'id_ref']])
+
+        property << @value if @value != nil
+        return property
+      end
+    end
+
+    # == Description
+    # A literature reference for a clade. It is recommended to use the 'doi'
+    # attribute instead of the free text 'desc' element whenever possible.
+    class Reference
+      # String. Digital Object Identifier.
+      attr_accessor :doi
+
+      # String. Free text description.
+      attr_accessor :desc
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        ref = LibXML::XML::Node.new('reference')
+        Writer.generate_xml(ref, self, [
+              [:attr, 'doi'],
+              [:simple, 'desc', @desc]])
+         return ref
+      end
+
+    end
+
+    # == Description
+    #
+    # This is used to express a typed relationship between two clades.
+    # For example it could be used to describe multiple parents of a clade.
+    class CladeRelation
+      # Float
+      attr_accessor :distance
+      # String. Id of the referenced parents of a clade.
+      attr_accessor :id_ref_0, :id_ref_1
+      # String
+      attr_accessor :type
+      # Confidence object
+      attr_accessor :confidence
+
+      def distance=(str)
+        @distance = str.to_f
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        if @id_ref_0 == nil or @id_ref_1 == nil or @type == nil
+          raise "Attributes id_ref_0, id_ref_1, type are required elements by SequenceRelation element."
+        else
+          cr = LibXML::XML::Node.new('clade_relation')
+          Writer.generate_xml(cr, self, [
+              [:attr, 'id_ref_0'],
+              [:attr, 'id_ref_1'],
+              [:attr, 'distance'],
+              [:attr, 'type'],
+              [:complex, 'confidence', @confidnece]])         
+
+          return cr
+        end
+      end
+
+    end
+
+
+    # == Description
+    # The names and/or counts of binary characters present, gained, and
+    # lost at the root of a clade.
+    class BinaryCharacters
+      attr_accessor :bc_type, :gained, :lost, :present, :absent
+      attr_reader :gained_count, :lost_count, :present_count, :absent_count
+
+      def gained_count=(str)
+        @gained_count = str.to_i
+      end
+
+      def lost_count=(str)
+        @lost_count = str.to_i
+      end
+
+      def present_count=(str)
+        @present_count = str.to_i
+      end
+
+      def absent_count=(str)
+        @absent_count = str.to_i
+      end
+
+      def initialize
+        @gained = []
+        @lost = []
+        @present = []
+        @absent = []
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        bc = LibXML::XML::Node.new('binary_characters')
+        bc['type'] = @bc_type
+        PhyloXML::Writer.generate_xml(bc, self, [
+            [:attr, 'gained_count'],
+            [:attr, 'lost_count'],
+            [:attr, 'present_count'],
+            [:attr, 'absent_count']])
+
+        if not @gained.empty?
+          gained_xml = LibXML::XML::Node.new('gained')
+          PhyloXML::Writer.generate_xml(gained_xml, self, [[:simplearr, 'bc', @gained]])
+          bc << gained_xml
+        end
+
+        if not @lost.empty?
+          lost_xml = LibXML::XML::Node.new('lost')
+          PhyloXML::Writer.generate_xml(lost_xml, self, [[:simplearr, 'bc', @lost]])
+          bc << lost_xml
+        end
+
+        if not @present.empty?
+          present_xml = LibXML::XML::Node.new('present')
+          PhyloXML::Writer.generate_xml(present_xml, self, [[:simplearr, 'bc', @present]])
+          bc << present_xml
+        end
+
+        if not @absent.empty?
+          absent_xml = LibXML::XML::Node.new('absent')
+          PhyloXML::Writer.generate_xml(absent_xml, self, [[:simplearr, 'bc', @absent]])
+          bc << absent_xml
+        end
+
+        return bc
+      end
+
+
+    end
+
+    # == Description
+    # This is used to express a typed relationship between two sequences.
+    # For example it could be used to describe an orthology (in which case
+    # attribute 'type' is 'orthology').
+    class SequenceRelation
+      # String
+      attr_accessor :id_ref_0, :id_ref_1, :type
+      # Float
+      attr_reader :distance
+
+      #@todo it has Confidences objects.
+
+      def distance=(str)
+        @distance = str.to_f if str != nil
+      end
+
+      def type=(str)
+        #@todo do warning instead?
+        #@todo do validation at actually writing xml
+        allowed_values = ["orthology", "one_to_one_orthology", "super_orthology", "paralogy",
+            "ultra_paralogy", "xenology", "unknown", "other"]
+        if not allowed_values.include? str
+          raise "SequenceRelation#type has to be one one of #{allowed_values.join("; ")}"
+        else
+          @type = str
+        end
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        if @id_ref_0 == nil or @id_ref_1 == nil or @type == nil
+          raise "Attributes id_ref_0, id_ref_1, type are required elements by SequenceRelation element."
+        else
+          sr = LibXML::XML::Node.new('sequence_relation')
+          sr['id_ref_0'] = @id_ref_0
+          sr['id_ref_1'] = @id_ref_1
+          sr['distance'] = @distance.to_s if @distance != nil
+          sr['type'] = @type
+          return sr
+        end
+      end
+
+    end
+
+   class Other
+      attr_accessor :element_name, :attributes, :children, :value
+      
+      def initialize
+        @children = []
+        @attributes = Hash.new
+      end
+
+      # Converts elements to xml representation. Called by PhyloXML::Writer class.
+      def to_xml
+        o = LibXML::XML::Node.new(@element_name)
+        @attributes.each do |key, value|
+          o[key] = value
+        end
+        o << value if value != nil
+        children.each do |child_node|
+          o << child_node.to_xml
+        end
+        return o
+      end
+      
+    end
+
+
+end #module PhyloXML
+
+end #end module Bio