Microhomology 0.1.0

checksums.yaml

@@ -0,0 +1,7 @@
+---
+SHA1:
+  metadata.gz: 82171a97b2db1812ff28de4c26ea59553418e012
+  data.tar.gz: 631e0439c1cf32ff546a14cd5aa8f5d1d7d6f4e7
+SHA512:
+  metadata.gz: 0980e8500d877fd6200611b3da128feaa5aa3cf9a90971206c5c4823e90b77db6d08c9fc71dba546781325689b84037578fb624b63b2eb982b80c08ffb39989e
+  data.tar.gz: a7bb1ed83705c59873633c87dc01977c5d711d5b2e31c2aa9fdd929a300975d9793be5c48d8dfa2f029c3b49a23c42db28b830537b0d674c8f3be9a316b315af

data/.gitignore

@@ -0,0 +1,17 @@
+*.gem
+*.rbc
+.bundle
+.config
+.yardoc
+Gemfile.lock
+InstalledFiles
+_yardoc
+coverage
+doc/
+lib/bundler/man
+pkg
+rdoc
+spec/reports
+test/tmp
+test/version_tmp
+tmp

data/.rspec

@@ -0,0 +1,2 @@
+--color
+--require spec_helper

data/.travis.yml

@@ -0,0 +1,5 @@
+language: ruby
+rvm:
+  - 2.0.0
+cache: bundler
+script: 'bundle exec rspec spec'

data/Gemfile

@@ -0,0 +1,4 @@
+source 'https://rubygems.org'
+
+# Specify your gem's dependencies in microhomology.gemspec
+gemspec

data/Guardfile

@@ -0,0 +1,70 @@
+# A sample Guardfile
+# More info at https://github.com/guard/guard#readme
+
+## Uncomment and set this to only include directories you want to watch
+# directories %w(app lib config test spec features) \
+#  .select{|d| Dir.exists?(d) ? d : UI.warning("Directory #{d} does not exist")}
+
+## Note: if you are using the `directories` clause above and you are not
+## watching the project directory ('.'), then you will want to move
+## the Guardfile to a watched dir and symlink it back, e.g.
+#
+#  $ mkdir config
+#  $ mv Guardfile config/
+#  $ ln -s config/Guardfile .
+#
+# and, you'll have to watch "config/Guardfile" instead of "Guardfile"
+
+# Note: The cmd option is now required due to the increasing number of ways
+#       rspec may be run, below are examples of the most common uses.
+#  * bundler: 'bundle exec rspec'
+#  * bundler binstubs: 'bin/rspec'
+#  * spring: 'bin/rspec' (This will use spring if running and you have
+#                          installed the spring binstubs per the docs)
+#  * zeus: 'zeus rspec' (requires the server to be started separately)
+#  * 'just' rspec: 'rspec'
+
+guard :rspec, cmd: "bundle exec rspec" do
+  require "guard/rspec/dsl"
+  dsl = Guard::RSpec::Dsl.new(self)
+
+  # Feel free to open issues for suggestions and improvements
+
+  # RSpec files
+  rspec = dsl.rspec
+  watch(rspec.spec_helper) { rspec.spec_dir }
+  watch(rspec.spec_support) { rspec.spec_dir }
+  watch(rspec.spec_files)
+
+  # Ruby files
+  ruby = dsl.ruby
+  dsl.watch_spec_files_for(ruby.lib_files)
+
+  # Rails files
+  rails = dsl.rails(view_extensions: %w(erb haml slim))
+  dsl.watch_spec_files_for(rails.app_files)
+  dsl.watch_spec_files_for(rails.views)
+
+  watch(rails.controllers) do |m|
+    [
+      rspec.spec.("routing/#{m[1]}_routing"),
+      rspec.spec.("controllers/#{m[1]}_controller"),
+      rspec.spec.("acceptance/#{m[1]}")
+    ]
+  end
+
+  # Rails config changes
+  watch(rails.spec_helper)     { rspec.spec_dir }
+  watch(rails.routes)          { "#{rspec.spec_dir}/routing" }
+  watch(rails.app_controller)  { "#{rspec.spec_dir}/controllers" }
+
+  # Capybara features specs
+  watch(rails.view_dirs)     { |m| rspec.spec.("features/#{m[1]}") }
+  watch(rails.layouts)       { |m| rspec.spec.("features/#{m[1]}") }
+
+  # Turnip features and steps
+  watch(%r{^spec/acceptance/(.+)\.feature$})
+  watch(%r{^spec/acceptance/steps/(.+)_steps\.rb$}) do |m|
+    Dir[File.join("**/#{m[1]}.feature")][0] || "spec/acceptance"
+  end
+end

data/LICENSE.txt

@@ -0,0 +1,22 @@
+Copyright (c) 2015 Chris Mikelson
+
+MIT License
+
+Permission is hereby granted, free of charge, to any person obtaining
+a copy of this software and associated documentation files (the
+"Software"), to deal in the Software without restriction, including
+without limitation the rights to use, copy, modify, merge, publish,
+distribute, sublicense, and/or sell copies of the Software, and to
+permit persons to whom the Software is furnished to do so, subject to
+the following conditions:
+
+The above copyright notice and this permission notice shall be
+included in all copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
+NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
+LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
+OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
+WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.

data/README.md

@@ -0,0 +1,156 @@
+![Microhomology Logo](https://raw.github.com/cmike444/microhomology/master/microhomology.png)
+
+By [Chris Mikelson](http://chrismikelson.com)
+
+[![Build Status](https://travis-ci.org/cmike444/microhomology.svg?branch=master)](https://travis-ci.org/cmike444/microhomology)
+
+Quickly perform microhomology to speed up genetic engineering. 
+
+With only a few lines of code, researchers can...
+
+*   Identify microhomology canidate sites in a gene
+*   Perform microhomology on sites using multiple strategies
+*   Get forward and reverse sequences for each strategy's results
+*   Get forward and reverse oligo sequences for each strategy's results
+
+This gem uses [BioRuby](https://rubygems.org/gems/bio) to easily obtain compliment pairs and traverse forward or reverse strands.
+
+## Installation
+
+Add this line to your application's Gemfile:
+
+```ruby
+gem 'microhomology'
+```
+
+Or install it yourself via Command Line Interface:
+
+```ruby
+$ gem install microhomology
+```
+
+## Usage
+
+>**Note:** This currently relies on the Ensembl REST API for it's data. DNA can only be obtained by using a valid Ensembl Gene ID. Additional options for obtaining DNA via other sources such as text files, formated files or 3rd Party API's is intended to be added at a later date.
+
+## The DNA
+The DNA from Ensembl is masked to differentiate between Introns and Exons. 
+
+>**Note:** The default is to scan only exons when using a microhomology strategy. Adding options to choose between exons, introns or include both is intended to be added at a later date.
+
+```ruby
+mh = Microhomology::Crispr.new('ENSDARG00000061303', [3, 6, 9])
+```
+
+```ruby
+mh.dna
+# TTTGCTGTGGTTTCACTCCTTCagaaggtcttatttgttttcttccag
+```
+
+```ruby
+mh.introns
+# agaaggtcttatttgttttcttccag
+```
+
+```ruby
+mh.exons
+# TTTGCTGTGGTTTCACTCCTTC
+```
+
+#### CRIPSR
+
+Perform microhomology on a DNA sequence using the [CRISPR](https://www.youtube.com/watch?v=2pp17E4E-O8) technique. This class takes two inputs, an Ensembl Gene ID _(string)_ and the microhomology strategies _(array)_. Using the DNA returned from Ensembl and the [CRISPR algorithm](lib/microhomology/strategies.rb), the DNA is scanned to identify target sites on both forward and reverse strands. Once target sites are identified, microhomology is performed according to each strategy in the array. 
+
+```ruby
+mh = Microhomology::Crispr.new('ENSDARG00000061303', [6, 12, 24, 48, 96])
+mh.results
+```
+
+```javascript
+    {
+    "target": "GGCCGATTCATTAATGCAGCTGG",
+    "first": 155,
+    "last": 178,
+    "microhomology": [
+      {
+        "strategy": "mh6",
+        "forward_strand": "TAATGC",
+        "reverse_strand": "ATTACG",
+        "mh6_oligo_forward": "TAATGCAGCTGG",
+        "mh6_oligo_reverse": "ATTACGTCGACC"
+      },
+      {
+        "strategy": "mh9",
+        "forward_strand": "CATTAATGC",
+        "reverse_strand": "GTAATTACG",
+        "mh9_oligo_forward": "CATTAATGCAGCTGG",
+        "mh9_oligo_reverse": "GTAATTACGTCGACC"
+      },
+      {
+        "strategy": "mh12",
+        "forward_strand": "ATTCATTAATGC",
+        "reverse_strand": "TAAGTAATTACG",
+        "mh12_oligo_forward": "ATTCATTAATGCAGCTGG",
+        "mh12_oligo_reverse": "TAAGTAATTACGTCGACC"
+      },
+      {
+        "strategy": "mh24",
+        "forward_strand": "GCGCGTTGGCCGATTCATTAATGC",
+        "reverse_strand": "CGCGCAACCGGCTAAGTAATTACG",
+        "mh24_oligo_forward": "GCGCGTTGGCCGATTCATTAATGCAGCTGG",
+        "mh24_oligo_reverse": "CGCGCAACCGGCTAAGTAATTACGTCGACC"
+      },
+      {
+        "strategy": "mh48",
+        "forward_strand": "CCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGC",
+        "reverse_strand": "GGTTATGCGTTTGGCGGAGAGGGGCGCGCAACCGGCTAAGTAATTACG",
+        "mh48_oligo_forward": "CCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG",
+        "mh48_oligo_reverse": "GGTTATGCGTTTGGCGGAGAGGGGCGCGCAACCGGCTAAGTAATTACGTCGACC"
+      }
+    ]
+  }
+```
+
+See an [CRISPR example](examples/crispr_example.rb) that prints out results to the console.
+
+#### TALEN
+
+Perform microhomology on a DNA sequence using the [TALEN](https://en.wikipedia.org/wiki/Transcription_activator-like_effector_nuclease) technique. This class takes one input, an Ensembl Gene ID _(string)_. Using the DNA returned from Ensembl and the [TALEN algorithm](lib/microhomology/strategies.rb), the DNA is scanned to identify target sites on both forward and reverse strands. Once target sites are identified, microhomology is performed. 
+
+```ruby
+mh = Microhomology::Talen.new('ENSDARG00000061303')
+mh.results
+```
+
+```javascript
+    {
+    "target": "TTGCTGTGGTTTCACTCCTTCATCTTCTTGAAGGAGCTCAACCTCCA",
+    "first": 1,
+    "last": 48,
+    "microhomology": [
+        {
+          "forward_strand": "TTGCTGTGGTTTCACTCCTTCATCTTCTTGAAGGAGCTCAACCTCCA",
+          "reverse_strand": "AACGACACCAAAGTGAGGAAGTAGAAGAACTTCCTCGAGTTGGAGGT",
+          "oligo_forward": "TTGCTGTGGTTTCACTCTTCTTGACCTTCATAGGAGCTCAACCTCCA",
+          "oligo_reverse": "AACGACACCAAAGTGAGAAGAACTGGAAGTATCCTCGAGTTGGAGGT"
+        },
+      ]
+    }
+```
+
+See an [TALEN example](examples/talen_example.rb) that prints out results to the console.
+
+## Roadmap
+Changes to this gem will be ongoing. If you would like to contribute, please follow the process below.
+
+* Better integration with Rails
+* Additional DNA data source options
+* Intron and Exon options
+
+## Contributing
+
+1. Fork it ( http://github.com/<my-github-username>/microhomology/fork )
+2. Create your feature branch (`git checkout -b my-new-feature`)
+3. Commit your changes (`git commit -am 'Add some feature'`)
+4. Push to the branch (`git push origin my-new-feature`)
+5. Create new Pull Request

data/Rakefile

@@ -0,0 +1,7 @@
+require 'rspec/core/rake_task'
+require 'bundler/gem_tasks'
+
+RSpec::Core::RakeTask.new
+
+task :default => :spec
+task :test => :spec

data/examples/crispr_example.rb

@@ -0,0 +1,26 @@
+require 'rubygems'
+require 'microhomology'
+
+mh = Microhomology::Crispr.new('ENSDARG00000061303', [6, 12, 24, 48, 96])
+puts ' '
+puts mh.key # The Ensembl Gene ID
+puts mh.dna # The DNA data
+puts mh.introns # The DNA data (only introns)
+puts mh.exons # The DNA data (only exons)
+puts mh.strategies # The microhomology strategies
+
+mh.results.each do |target|
+  puts ' '
+  puts "Target: " + target['target'] # Identified target site
+  puts "First: " + target['first'].to_s # Position (from left) of first base pair
+  puts "Last: " + target['last'].to_s # Position (from left) of last base pair
+
+  target['microhomology'].each do |result| 
+    puts " "
+    puts "   Strategy: " + result["strategy"].to_s # Microhomology strategy
+    puts "   Forward: " + result["forward_strand"] # Forward Strand
+    puts "   Reverse: " + result["reverse_strand"] # Reverse Strand
+    puts "   Oligo Forward: " + result["oligo_forward"] # Oligo Forward Strand
+    puts "   Oligo Reverse: " + result["oligo_reverse"] # Oligo Reverse Strand
+  end
+end

data/examples/talen_example.rb

@@ -0,0 +1,24 @@
+require 'rubygems'
+require 'microhomology'
+
+mh = Microhomology::Talen.new('ENSDARG00000061303')
+puts ' '
+puts mh.key # The Ensembl Gene ID
+puts mh.dna # The DNA data
+puts mh.introns # The DNA data (only introns)
+puts mh.exons # The DNA data (only exons)
+
+mh.results.each do |target|
+  puts ' '
+  puts "Target: " + target['target'] # Identified target site
+  puts "First: " + target['first'].to_s # Position (from left) of first base pair
+  puts "Last: " + target['last'].to_s # Position (from left) of last base pair
+
+  target['microhomology'].each do |result| 
+    puts " "
+    puts "   Forward: " + result["forward_strand"] # Forward Strand
+    puts "   Reverse: " + result["reverse_strand"] # Reverse Strand
+    puts "   Oligo Forward: " + result["oligo_forward"] # Oligo Forward Strand
+    puts "   Oligo Reverse: " + result["oligo_reverse"] # Oligo Reverse Strand
+  end
+end

data/lib/microhomology.rb

@@ -0,0 +1,135 @@
+require "microhomology/version"
+require "microhomology/strategies"
+require 'bio'
+require 'json'
+require "open-uri"
+
+module Microhomology
+  
+  class Crispr
+    attr_accessor :key, :strategies, :dna, :results
+    
+    def initialize(key, strategies)
+      @key = key 
+      @strategies = strategies
+      @dna = open(get_ensembl_url).read
+      @results = perform_microhomology
+    end
+
+    def get_ensembl_url
+      "http://rest.ensembl.org/sequence/id/#{self.key}?content-type=text/plain;mask_feature=true"
+    end
+
+    def get_bio_sequence
+      Bio::Sequence::NA.new(self.dna)
+    end
+
+    def exons
+      self.dna.scan /[A-Z]+/
+    end
+
+    def introns
+      self.dna.scan /[a-z]+/
+    end
+
+    def perform_microhomology
+      targets = []
+      self.dna.scan(Microhomology::CRISPR) do |crispr|
+        # Compile first set of data to JSON
+        targets << {
+                    "target" => crispr,
+                    "first" => Regexp.last_match.offset(0).first, 
+                    "last" => Regexp.last_match.offset(0).last,
+                    "microhomology" => []
+                    }
+      end
+
+      if targets
+        targets.each do |target|
+
+          self.strategies.each do |strategy|
+            # Double strand break based on polarity
+            if target["target"][0] == "G"
+              mh_last_char = target["last"] - 7
+            else
+              mh_last_char = target["first"] + 5
+            end
+              mh_first_char = mh_last_char - (strategy - 1)
+
+            target["microhomology"] << { 
+              "strategy" => "#{strategy}",
+              "forward_strand" => get_bio_sequence[mh_first_char..mh_last_char].upcase,
+              "reverse_strand" => get_bio_sequence[mh_first_char..mh_last_char].complement.reverse.upcase,
+              "oligo_forward" => get_bio_sequence[mh_first_char...target["last"]].upcase,
+              "oligo_reverse" => get_bio_sequence[mh_first_char...target["last"]].complement.reverse.upcase
+            }
+          end
+        end
+        targets
+      else
+        "Sorry, no CRISPR targets found."
+      end
+    end
+  end
+
+  class Talen
+    attr_accessor :key, :dna, :results
+
+    def initialize(key)
+      @key = key
+      @dna = open(get_ensembl_url).read
+      @results = perform_microhomology
+    end
+
+    def get_ensembl_url
+      "http://rest.ensembl.org/sequence/id/#{self.key}?content-type=text/plain;mask_feature=true"
+    end
+
+    def exons
+      self.dna.scan /[A-Z]+/
+    end
+
+    def introns
+      self.dna.scan /[a-z]+/
+    end
+
+    def perform_microhomology
+      targets = []
+      self.dna.scan(Microhomology::TALEN) do |talen|
+        targets << {
+                    "target" => talen,
+                    "first" => Regexp.last_match.offset(0).first, 
+                    "last" => Regexp.last_match.offset(0).last,
+                    "microhomology" => []
+                    }
+      end
+
+      if targets
+        targets.each do |target|
+
+          talen_site = Bio::Sequence::NA.new(target['target'])
+          talen_site_complement = talen_site.complement.reverse
+
+          talen1  = talen_site[0..15]
+          spacer1 = talen_site[16..22]
+          spacer2 = talen_site[23..30]
+          talen2  = talen_site[31..47]
+
+          talen_forward = Bio::Sequence::NA.new("#{talen1}#{spacer2}#{spacer1}#{talen2}")
+          talen_reverse = talen_forward.complement.reverse
+
+          target["microhomology"] << { 
+              "forward_strand" => "#{talen_site.upcase}",
+              "reverse_strand" => "#{talen_site_complement.upcase}",
+              "oligo_forward" => "#{talen_forward.upcase}",
+              "oligo_reverse" => "#{talen_reverse.upcase}"
+            }
+        end
+        targets
+      else
+        "Sorry, no TALEN targets found."
+      end
+    end
+
+  end
+end

data/lib/microhomology/strategies.rb

@@ -0,0 +1,4 @@
+module Microhomology
+  TALEN = /[T].{45}[A]/
+  CRISPR = /[G][G].{19}[G][G]|[C][C].{19}[C][C]/
+end

data/lib/microhomology/version.rb

@@ -0,0 +1,3 @@
+module Microhomology
+  VERSION = "0.1.0"
+end

data/microhomology.gemspec

@@ -0,0 +1,30 @@
+# coding: utf-8
+lib = File.expand_path('../lib', __FILE__)
+$LOAD_PATH.unshift(lib) unless $LOAD_PATH.include?(lib)
+require 'microhomology/version'
+
+Gem::Specification.new do |spec|
+  spec.name          = "Microhomology"
+  spec.version       = Microhomology::VERSION
+  spec.authors       = ["Chris Mikelson"]
+  spec.email         = ["chrismikelson@gmail.com"]
+  spec.summary       = %q{Perform simultaneous microhomology strategies with ease using CRISPR or TALEN techniques.}
+  spec.description   = %q{Simultaneously perform custom microhomoly strategies for genetic engineering and bioinformatics.}
+  spec.homepage      = "https://github.com/cmike444/microhomology"
+  spec.license       = "MIT"
+
+  spec.files         = `git ls-files -z`.split("\x0")
+  spec.executables   = spec.files.grep(%r{^bin/}) { |f| File.basename(f) }
+  spec.test_files    = spec.files.grep(%r{^(test|spec|features)/})
+  spec.require_paths = ["lib"]
+
+  spec.add_development_dependency "bundler", "~> 1.5"
+  spec.add_development_dependency "rake", '~> 0'
+  spec.add_development_dependency "rspec"
+  spec.add_development_dependency "guard"
+  spec.add_development_dependency "guard-rspec"
+  spec.add_development_dependency "coveralls"
+
+  spec.add_runtime_dependency "json", '~> 1.8', '>= 1.8.3'
+  spec.add_runtime_dependency "bio", '~> 1.5', '>= 1.5.0'
+end

data/spec/microhomology_helper.rb

@@ -0,0 +1,10 @@
+require 'spec_helper'
+
+describe Microhomology do
+  context "on new crispr" do
+    it "adds key to ensembl url" do
+      crispr = Microhomology::Crispr.new('ENSDARG00000061303', [6, 12, 24, 48, 96])
+      expect(crispr.get_ensembl_url).to eq "http://rest.ensembl.org/sequence/id/ENSDARG00000061303?content-type=text/plain;mask_feature=true"
+    end
+  end
+end

data/spec/spec_helper.rb

@@ -0,0 +1,99 @@
+# This file was generated by the `rspec --init` command. Conventionally, all
+# specs live under a `spec` directory, which RSpec adds to the `$LOAD_PATH`.
+# The generated `.rspec` file contains `--require spec_helper` which will cause
+# this file to always be loaded, without a need to explicitly require it in any
+# files.
+#
+# Given that it is always loaded, you are encouraged to keep this file as
+# light-weight as possible. Requiring heavyweight dependencies from this file
+# will add to the boot time of your test suite on EVERY test run, even for an
+# individual file that may not need all of that loaded. Instead, consider making
+# a separate helper file that requires the additional dependencies and performs
+# the additional setup, and require it from the spec files that actually need
+# it.
+#
+# The `.rspec` file also contains a few flags that are not defaults but that
+# users commonly want.
+#
+# See http://rubydoc.info/gems/rspec-core/RSpec/Core/Configuration
+
+require 'microhomology'
+
+RSpec.configure do |config|
+  # rspec-expectations config goes here. You can use an alternate
+  # assertion/expectation library such as wrong or the stdlib/minitest
+  # assertions if you prefer.
+  config.expect_with :rspec do |expectations|
+    # This option will default to `true` in RSpec 4. It makes the `description`
+    # and `failure_message` of custom matchers include text for helper methods
+    # defined using `chain`, e.g.:
+    #     be_bigger_than(2).and_smaller_than(4).description
+    #     # => "be bigger than 2 and smaller than 4"
+    # ...rather than:
+    #     # => "be bigger than 2"
+    expectations.include_chain_clauses_in_custom_matcher_descriptions = true
+  end
+
+  # rspec-mocks config goes here. You can use an alternate test double
+  # library (such as bogus or mocha) by changing the `mock_with` option here.
+  config.mock_with :rspec do |mocks|
+    # Prevents you from mocking or stubbing a method that does not exist on
+    # a real object. This is generally recommended, and will default to
+    # `true` in RSpec 4.
+    mocks.verify_partial_doubles = true
+  end
+
+# The settings below are suggested to provide a good initial experience
+# with RSpec, but feel free to customize to your heart's content.
+=begin
+  # These two settings work together to allow you to limit a spec run
+  # to individual examples or groups you care about by tagging them with
+  # `:focus` metadata. When nothing is tagged with `:focus`, all examples
+  # get run.
+  config.filter_run :focus
+  config.run_all_when_everything_filtered = true
+
+  # Allows RSpec to persist some state between runs in order to support
+  # the `--only-failures` and `--next-failure` CLI options. We recommend
+  # you configure your source control system to ignore this file.
+  config.example_status_persistence_file_path = "spec/examples.txt"
+
+  # Limits the available syntax to the non-monkey patched syntax that is
+  # recommended. For more details, see:
+  #   - http://myronmars.to/n/dev-blog/2012/06/rspecs-new-expectation-syntax
+  #   - http://www.teaisaweso.me/blog/2013/05/27/rspecs-new-message-expectation-syntax/
+  #   - http://myronmars.to/n/dev-blog/2014/05/notable-changes-in-rspec-3#new__config_option_to_disable_rspeccore_monkey_patching
+  config.disable_monkey_patching!
+
+  # This setting enables warnings. It's recommended, but in some cases may
+  # be too noisy due to issues in dependencies.
+  config.warnings = true
+
+  # Many RSpec users commonly either run the entire suite or an individual
+  # file, and it's useful to allow more verbose output when running an
+  # individual spec file.
+  if config.files_to_run.one?
+    # Use the documentation formatter for detailed output,
+    # unless a formatter has already been configured
+    # (e.g. via a command-line flag).
+    config.default_formatter = 'doc'
+  end
+
+  # Print the 10 slowest examples and example groups at the
+  # end of the spec run, to help surface which specs are running
+  # particularly slow.
+  config.profile_examples = 10
+
+  # Run specs in random order to surface order dependencies. If you find an
+  # order dependency and want to debug it, you can fix the order by providing
+  # the seed, which is printed after each run.
+  #     --seed 1234
+  config.order = :random
+
+  # Seed global randomization in this process using the `--seed` CLI option.
+  # Setting this allows you to use `--seed` to deterministically reproduce
+  # test failures related to randomization by passing the same `--seed` value
+  # as the one that triggered the failure.
+  Kernel.srand config.seed
+=end
+end

metadata

@@ -0,0 +1,189 @@
+--- !ruby/object:Gem::Specification
+name: Microhomology
+version: !ruby/object:Gem::Version
+  version: 0.1.0
+platform: ruby
+authors:
+- Chris Mikelson
+autorequire: 
+bindir: bin
+cert_chain: []
+date: 2015-09-27 00:00:00.000000000 Z
+dependencies:
+- !ruby/object:Gem::Dependency
+  name: bundler
+  requirement: !ruby/object:Gem::Requirement
+    requirements:
+    - - ~>
+      - !ruby/object:Gem::Version
+        version: '1.5'
+  type: :development
+  prerelease: false
+  version_requirements: !ruby/object:Gem::Requirement
+    requirements:
+    - - ~>
+      - !ruby/object:Gem::Version
+        version: '1.5'
+- !ruby/object:Gem::Dependency
+  name: rake
+  requirement: !ruby/object:Gem::Requirement
+    requirements:
+    - - ~>
+      - !ruby/object:Gem::Version
+        version: '0'
+  type: :development
+  prerelease: false
+  version_requirements: !ruby/object:Gem::Requirement
+    requirements:
+    - - ~>
+      - !ruby/object:Gem::Version
+        version: '0'
+- !ruby/object:Gem::Dependency
+  name: rspec
+  requirement: !ruby/object:Gem::Requirement
+    requirements:
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: '0'
+  type: :development
+  prerelease: false
+  version_requirements: !ruby/object:Gem::Requirement
+    requirements:
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: '0'
+- !ruby/object:Gem::Dependency
+  name: guard
+  requirement: !ruby/object:Gem::Requirement
+    requirements:
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: '0'
+  type: :development
+  prerelease: false
+  version_requirements: !ruby/object:Gem::Requirement
+    requirements:
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: '0'
+- !ruby/object:Gem::Dependency
+  name: guard-rspec
+  requirement: !ruby/object:Gem::Requirement
+    requirements:
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: '0'
+  type: :development
+  prerelease: false
+  version_requirements: !ruby/object:Gem::Requirement
+    requirements:
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: '0'
+- !ruby/object:Gem::Dependency
+  name: coveralls
+  requirement: !ruby/object:Gem::Requirement
+    requirements:
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: '0'
+  type: :development
+  prerelease: false
+  version_requirements: !ruby/object:Gem::Requirement
+    requirements:
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: '0'
+- !ruby/object:Gem::Dependency
+  name: json
+  requirement: !ruby/object:Gem::Requirement
+    requirements:
+    - - ~>
+      - !ruby/object:Gem::Version
+        version: '1.8'
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: 1.8.3
+  type: :runtime
+  prerelease: false
+  version_requirements: !ruby/object:Gem::Requirement
+    requirements:
+    - - ~>
+      - !ruby/object:Gem::Version
+        version: '1.8'
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: 1.8.3
+- !ruby/object:Gem::Dependency
+  name: bio
+  requirement: !ruby/object:Gem::Requirement
+    requirements:
+    - - ~>
+      - !ruby/object:Gem::Version
+        version: '1.5'
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: 1.5.0
+  type: :runtime
+  prerelease: false
+  version_requirements: !ruby/object:Gem::Requirement
+    requirements:
+    - - ~>
+      - !ruby/object:Gem::Version
+        version: '1.5'
+    - - '>='
+      - !ruby/object:Gem::Version
+        version: 1.5.0
+description: Simultaneously perform custom microhomoly strategies for genetic engineering
+  and bioinformatics.
+email:
+- chrismikelson@gmail.com
+executables: []
+extensions: []
+extra_rdoc_files: []
+files:
+- .gitignore
+- .rspec
+- .travis.yml
+- Gemfile
+- Guardfile
+- LICENSE.txt
+- README.md
+- Rakefile
+- examples/crispr_example.rb
+- examples/talen_example.rb
+- lib/microhomology.rb
+- lib/microhomology/strategies.rb
+- lib/microhomology/version.rb
+- microhomology.gemspec
+- microhomology.png
+- spec/microhomology_helper.rb
+- spec/spec_helper.rb
+homepage: https://github.com/cmike444/microhomology
+licenses:
+- MIT
+metadata: {}
+post_install_message: 
+rdoc_options: []
+require_paths:
+- lib
+required_ruby_version: !ruby/object:Gem::Requirement
+  requirements:
+  - - '>='
+    - !ruby/object:Gem::Version
+      version: '0'
+required_rubygems_version: !ruby/object:Gem::Requirement
+  requirements:
+  - - '>='
+    - !ruby/object:Gem::Version
+      version: '0'
+requirements: []
+rubyforge_project: 
+rubygems_version: 2.2.1
+signing_key: 
+specification_version: 4
+summary: Perform simultaneous microhomology strategies with ease using CRISPR or TALEN
+  techniques.
+test_files:
+- spec/microhomology_helper.rb
+- spec/spec_helper.rb